Data format

Data should be in fasta format. If more than two sequences are submitted, only the first two sequences will be processed.

The only nucleotides allowed are A, C, G, T, U, N, -.
The N and - are treated as gaps. In the output T is printed as U.

Fasta format for scanning

Search for multiple local hits. Max sequence length 10,000 and Max motif length (lambda) 1,000.
>V00158_694-623
UUAAUAAUGAUGCCUUUUUAGCUCAGUGGUAGAGCAUUGUAUUUGUAAUGCGGUGGUCGU
CGGUUCGAAUCCGACAAAAGGCUUGUGUGCAGAUGUAGCUCAGUGGUAGAGCGCAACCUU
GCCAAGGUUGAUGCCAUGGGUUCGAGUCCCAUUAUCUGCUUAUAGAUUUUAGGGCGGAGU
AGAGCAGUCAGGUAGCUCGCAGGGCUCAUAAUCCUGAAGUCAGAGGUUCAAAUCCUUUCU
CCGCUACAUCAAUUUUUGCAUAUUUCAAAUAAAUAAAUUUUAUAAAUUUCUUUAUUUUUA
AUAUAAUACUUUCUUAGUAUUUUAUUAAUUUACUGUUUGUUCAUAUUUAAAAUUAAAAUC
AUUGUGUAAAAUAUUUCAUUUUGCAGAUAUAUUUAUAGAUUCAAAGAGUUCUUAAUAAAA
AAGGAGAAGAAGGGAUUUGAACCCUCGGUGUUUAUUAGACACACUCGAUUAGCAAUCGAG
CUCUUUCGACCACUCAGACA
>AC069454_82192-82263
CCCUGGAGCUGGGGUUGGAGCAGGCUUUCCCUGGACCCAGUCCGGCCCCACAUCGCCAAC
CCCGCCAGCCUGCUGCCUUUCCGACCUCCCAGCCCCCGGAGGAGCGCAGGAAGACAUGAU
AUCCCCGGGACCAGAAACGCCGGGAACACGAAGGACGCAGAAGCCCUCGCCACGCCGCCC
GUGGGGCCCCGGUCCAGGGCCCAGUCCCUCAAACACGGACACCGCUGCCGCUCUGGAAAG
GCCGCCCAGAGCCCUCCUAGCUUGAGGAGACUCGCGGCCGCCUUAAGAAGCCAGCAGGUC
CCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGG
UGGGACCUCACGAGACUUUUUGGUCCUACAAUUCCUGUUUUGGAGACCGCUUCCGGCAGC
AGCCACCUCGGGCUGUGUGGGUAGCCUCACUGACCUGGCCUACAGCGGCUUGGGGUCCCU
CCCCCUCUCUCAAGAUGUUU

Fasta format for local and global alignment

Local or global alignment of the sequences. Max sequence length is 1,000. For global alignment the delta parameter has to be larger than the length difference between the sequences
>V00158/694-623 DG2520
GCAGAUGUAGCUCAGUGGUAGAGCGCAACCUUGCCAAGGUUGAUGCCAUGGGUUCGAGUC
CCAUUAUCUGCU
>AC069454/82192-82263 DQ9355
GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUC
UCGGUGGGACCU