This toy example illustrates the input and output of the PETcofold web server.
The interaction example of snoRNA mgU6-77 and U6 snRNA by selecting U6 Rfam seed alignment, you will find here.

Input

RNA alignment

The two alignments in FASTA format look like this, download the alignment files:
example1.fasta, example2.fasta.

>gca_bovine
AGCCCUGUGGUGAAUUUACACGUUGAAUUGGGGGCUU
>gca_chicken
GACUCUGUAGUGAAGU-UCAUAAUGAGUUGGGGGUCU
>gca_mouse
GGUCUUAAGGUGAUA-UUCAUGUCGAAUUGGAGACUU
>gca_rat
AGCCUUAAGGUGAUU-AUCAUGUCGAAUUGAGGGCUU
>gca_bovine
GAGGCCGGUCAAAUUCAGAUCAAU-CCGGCCA
>gca_chicken
GAGGCCCACCAAACUCGUUUAA-AGUGGGCCA
>gca_mouse
GGCGUUGGGCAAACUCGAAAAAU-CCCAACGU
>gca_rat
GGGGUUGGGCAAACUCGAAAAUCUACCAACUA

Note that the identifiers in both alignments must be the same.

Phylogenetic tree (optional)

The phylogenetic tree in Newick format looks like this:

((gca_rat:0.01783,gca_mouse:0.070947):0.29012,gca_chicken:0.372963,gca_bovine:0.159582):0.001;

Note that the names in the tree must match the names in the alignment file.

RNA secondary structure of duplex (optional)

The RNA secondary structure of duplex in dot-bracket format looks like this:

.((((.................[[[[[[[[.))))..&..((((((.]].]]]]]].......)))))).

Note that the length of the structure has to be the same as for the concatenated alignments.

Output

The output shows the input, the phylogenetic tree, the PETcofold plain text output including the predicted joint RNA secondary structure and score, an image of the covariance information in the joint RNA multiple alignment, and a dotplot of base pair and single stranded reliabilities calculated by the PETcofold scoring scheme:

Joint phylogenetic tree


Download PS | PDF | Newick format

PETcofold output

1st step - intra-molecular folding using PETfold

2nd step - inter-molecular cofolding

Download full output (verbose mode)

Predicted consensus joint RNA secondary structure


Download PS | PDF


Download SVG | PS | PDF

Dotplot of PETcofold reliabilities of base pairs and single stranded positions


Download PS | PDF | dotplot file