This page is about RIsearch 1.x, for the suffix array-based RIsearch2 see here.

Brief background

Regulatory, non-coding RNAs often function by duplex formation with other RNAs. Being able to predict these interactions in silico on a genome-wide scale is crucial to find possible targets for (and assign function to) ncRNA candidates, e.g. derived from computational screens. RIsearch is a program for fast RNA–RNA interaction search. It employs a modified Smith–Waterman–Gotoh algorithm based on di-nucleotides to approximate nearest-neighbor energy parameters.

Get software

You can download the software here

• 2014-04-23: Version 1.1 RIsearch-1.1.tar.gz
• 2013-01-11: Version 1.0 RIsearch-1.0.tar.gz

Installation

After download, unpack and compile with the following commands:

tar -xzvf RIsearch-1.1.tar.gz
cd RIsearch-1.1
make

This will create a standalone executable 'RIsearch'.
For more convenient use, add the installation folder to PATH or copy the binary to a location that is in $PATH, i.e.

cp RIsearch /usr/local/bin/.

Usage

Required Parameters

RIsearch expects at least two parameters: query and target sequences, these can be given as fasta formatted files:

RIsearch -q query.fa -t target.fa

or directly on the command line:

RIsearch -Q acguacgu -T cgauagcuguagacugaugcau

A mixture of both is allowed as well.
With multiple sequences in fasta files, RIsearch does an all-against-all comparison.

Optional Parameters

-d <int>   per-nucleotide extension penalty to favor short stable interactions,
             to be given in dacal/mol (recommended: 30, default: 0)
-s <int>   threshold for suboptimal duplexes (minimum score, NOT energy)
-n <int>   neighborhood (only backtrack from best position within this range -
             to omit many overlapping results); default is 0, backtrack all
-l <int>   max trace back length (default: 40)
-m <str>   scoring scheme to use, specify t99 to use the matrix based on 
             Turner 1999 parameters (default is t04, Turner 2004)
-e <num>   energy threshold
-p[123]    switch for short output (one line per hit), different formats

Find more details and examples in the inlcuded README file.

Citation

When using this software, please cite:

Found

The document has moved here.

Contact

wenzel@rth.dk