Emb1-C0005181_J05
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
GGTGAAAGGGCTATGGAACTACTGATAGACTACGAATATACCTCCCATATAACTGTGGAA CAGGGCAATGTTCATACCCTTCTGCCAACTGCTTGCCTCCTCCAACTGGCAGAA |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
GGTGAAAGGGCTATGGAACTACTGATAGACTACGAATATACCTCCCATATAACTGTGGAA CAGGGCAATGTTCATACCCTTCTGCCAACTGCTTGCCTCCTCCAACTGGCAGAA |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
3-114, gnl|bosTau2|chr16 (41845329-41845440) | |
3-114, gnl|Hg17|chr1 (170434830-170434941) | |
3-114, gnl|Mm7|chr1 (161071844-161071733) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
3-114, gnl|bosTau2|chr16 (41845329-41845440) | |
3-114, gnl|Hg17|chr1 (170434830-170434941) | |
3-114, gnl|Mm7|chr1 (161071844-161071733) |