Non-Coding RNA Search

Fat1-C94676

Sequence:


               
               CCTTCCCCCCAGTTATCTTCCCCCAACCCAATCCCTACCGCCCTCCCTGGACTTGGGGCT
TCTGGACCTTTGGCCCTTGCCCCCTGGGGGACCCAGACCTCTGGACTCTTGCTTCTGGCC
CTTGCAGAGACCCAGGCATCCGACACCCCCATCCCTGCCCAAGTGTCTGAGGTGTTAGTG
GTGGGGGGAGAAGCCCACCATCCCAGACTCTGATAAATGTCTTTGCAGCTGGCAGTGGGG
TGGAC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CCTTCCCCCCAGTTATCTTCCCCCAACCCAATCCCTACCGCCCTCCCTGGACTTGGGGCT
TCTGGACCTTTGGCCCTTGCCCCCTGGGGGACCCAGACCTCTGGACTCTTGCTTCTGGCC
CTTGCAGAGACCCAGGCATCCGACACCCCCATCCCTGCCCAAGTGTCTGAGGTGTTAGTG
GTGGGGGGAGAAGCCCACCATCCCAGACTCTGATAAATGTCTTTGCAGCTGGCAGTGGGG
TGGAC

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               1-245, - strand, RNAz p=0.999908

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-245, - strand, RNAz p=0.999908

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               6-226, DB503578 RIKEN full-length enriched human cDNA library, 
(dbj|DB503578.1|), blast E-value=0, identity=93.67% 
               

               
               1-226, AGENCOURT_14364476 NIH_MGC_181 Homo sapiens cDNA clone (gb|CD516265.1|), 
blast E-value=0, identity=92.11% 
               

               
               6-226, 56030826H1 FLP Homo sapiens cDNA, mRNA sequence (gb|CD637288.1|), blast 
E-value=0, identity=92.76% 
               

               
               6-226, 56030826J1 FLP Homo sapiens cDNA, mRNA sequence (gb|CD637289.1|), blast 
E-value=0, identity=93.67% 
               

               
               6-245, BovGen_17977 normal cattle brain Bos taurus cDNA clone (gb|CO889652.1|), 
blast E-value=0, identity=93.03% 
               

               
               6-245, LB0284.CR_A22 GC_BGC-28 Bos taurus cDNA clone IMAGE (gb|DV907828.1|), 
blast E-value=0, identity=93.03%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               6-226, DB503578 RIKEN full-length enriched human cDNA library, 
(dbj|DB503578.1|), blast E-value=0, identity=93.67% 
               

               
               1-226, AGENCOURT_14364476 NIH_MGC_181 Homo sapiens cDNA clone (gb|CD516265.1|), 
blast E-value=0, identity=92.11% 
               

               
               6-226, 56030826H1 FLP Homo sapiens cDNA, mRNA sequence (gb|CD637288.1|), blast 
E-value=0, identity=92.76% 
               

               
               6-226, 56030826J1 FLP Homo sapiens cDNA, mRNA sequence (gb|CD637289.1|), blast 
E-value=0, identity=93.67% 
               

               
               6-245, BovGen_17977 normal cattle brain Bos taurus cDNA clone (gb|CO889652.1|), 
blast E-value=0, identity=93.03% 
               

               
               6-245, LB0284.CR_A22 GC_BGC-28 Bos taurus cDNA clone IMAGE (gb|DV907828.1|), 
blast E-value=0, identity=93.03%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               5' of NM_145296, -

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               5' of NM_145296, -

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-245, gnl|bosTau2|chr18 (46212732-46212485)
               

               
               1-245, gnl|Hg17|chr19 (48819026-48819280)
               

               
               1-245, gnl|Mm7|chr7 (21291444-21291183)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-245, gnl|bosTau2|chr18 (46212732-46212485)
               

               
               1-245, gnl|Hg17|chr19 (48819026-48819280)
               

               
               1-245, gnl|Mm7|chr7 (21291444-21291183)

	6-226, DB503578 RIKEN full-length enriched human cDNA library, (dbj\|DB503578.1\|), blast E-value=0, identity=93.67%
	1-226, AGENCOURT_14364476 NIH_MGC_181 Homo sapiens cDNA clone (gb\|CD516265.1\|), blast E-value=0, identity=92.11%
	6-226, 56030826H1 FLP Homo sapiens cDNA, mRNA sequence (gb\|CD637288.1\|), blast E-value=0, identity=92.76%
	6-226, 56030826J1 FLP Homo sapiens cDNA, mRNA sequence (gb\|CD637289.1\|), blast E-value=0, identity=93.67%
	6-245, BovGen_17977 normal cattle brain Bos taurus cDNA clone (gb\|CO889652.1\|), blast E-value=0, identity=93.03%
	6-245, LB0284.CR_A22 GC_BGC-28 Bos taurus cDNA clone IMAGE (gb\|DV907828.1\|), blast E-value=0, identity=93.03%

	1-245, gnl\|bosTau2\|chr18 (46212732-46212485)
	1-245, gnl\|Hg17\|chr19 (48819026-48819280)
	1-245, gnl\|Mm7\|chr7 (21291444-21291183)