Fat1-PT31A12
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGACTTAAAAAATTGGGTTTCTATAGAAAACTTTTTTTTTTTTTTAAATGNGCAGGCTAT TCAAGTTCAATAGTAAAAGCTCAAAATTGAATGTTCTACTCCATGCTGAAGG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGACTTAAAAAATTGGGTTTCTATAGAAAACTTTTTTTTTTTTTTAAATGNGCAGGCTAT TCAAGTTCAATAGTAAAAGCTCAAAATTGAATGTTCTACTCCATGCTGAAGG |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-112, gnl|bosTau2|chr6 (66609640-66609527) | |
| 1-112, gnl|Hg17|chr9 (14073531-14073413) | |
| 1-112, gnl|Mm7|chr4 (81695624-81695517) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-112, gnl|bosTau2|chr6 (66609640-66609527) | |
| 1-112, gnl|Hg17|chr9 (14073531-14073413) | |
| 1-112, gnl|Mm7|chr4 (81695624-81695517) |