Liv1-LVRM10133A12
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| ACAGGGCACCGTGCTCCATTGCTCCGGAGCCTGCTGGTGGGGGAAGTGTGCGTGGCGGGG GTTACGCTTCTGAGTGTGGGGGGCCCCATCTGGGGAGTGGGACTTCCAGGCTTGGGTGGG GCTCCCAACCTGCAATCTTCCTGCCCCACATAATGTTTTCTCTGCCCTTTAAGCAGCTTG AGTCGGGCAGGGCCCCTCCCTCTG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| ACAGGGCACCGTGCTCCATTGCTCCGGAGCCTGCTGGTGGGGGAAGTGTGCGTGGCGGGG GTTACGCTTCTGAGTGTGGGGGGCCCCATCTGGGGAGTGGGACTTCCAGGCTTGGGTGGG GCTCCCAACCTGCAATCTTCCTGCCCCACATAATGTTTTCTCTGCCCTTTAAGCAGCTTG AGTCGGGCAGGGCCCCTCCCTCTG |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 36-204, + strand, RNAz p=0.999922 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 36-204, + strand, RNAz p=0.999922 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_015481, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-204, gnl|bosTau2|chr5 (16413975-16414182) | |
| 1-204, gnl|Hg17|chr12 (53064791-53064584) | |
| 1-204, gnl|Mm7|chr15 (103322201-103321988) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-204, gnl|bosTau2|chr5 (16413975-16414182) | |
| 1-204, gnl|Hg17|chr12 (53064791-53064584) | |
| 1-204, gnl|Mm7|chr15 (103322201-103321988) |