Lym1-jns24_H03.f
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AAAAGGGGGAATGGGTTCCTTTTTGGAAAAACTGAAAATTTAATAAAAATTAAAATAACC CAAGTTTTAAAAAACCCACCCCCTGAAGTTTCCACCTCCTGCCTTTGGCCCTCCAAAGGG ATGAGGCCCCAACCCCAGGGCAAAAAAAGGGGGGGGGCTTTTTGC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AAAAGGGGGAATGGGTTCCTTTTTGGAAAAACTGAAAATTTAATAAAAATTAAAATAACC CAAGTTTTAAAAAACCCACCCCCTGAAGTTTCCACCTCCTGCCTTTGGCCCTCCAAAGGG ATGAGGCCCCAACCCCAGGGCAAAAAAAGGGGGGGGGCTTTTTGC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 8-165, - strand, RNAz p=0.991382 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 8-165, - strand, RNAz p=0.991382 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 49-166, - strand, RNAmicro p=0.993775 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_005273, - |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 8-165, gnl|bosTau2|chr25 (32319029-32319186) | |
| 8-165, gnl|Hg17|chr7 (99921434-99921277) | |
| 8-165, gnl|Mm7|chr5 (136446404-136446559) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 8-165, gnl|bosTau2|chr25 (32319029-32319186) | |
| 8-165, gnl|Hg17|chr7 (99921434-99921277) | |
| 8-165, gnl|Mm7|chr5 (136446404-136446559) |