Lym1-jns67_G09.f
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
AAAAAGGCCAAGAAAAAAAACAATTTTTTTTAGGGGGAAAAAAAATTTTTCATCCAAAAT ATAAAAATTGGGACAACTTTGCCCCAATCAATATACAGGAACGGGACAAATTTACCCCAG TTCATATTTTCCCAAAAAAAAGGGGGCTAACAAGGTTCACAAAATAGAGGGGGGGTGGGG GAAAAAACTTTTCCCCAATTAAG |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
AAAAAGGCCAAGAAAAAAAACAATTTTTTTTAGGGGGAAAAAAAATTTTTCATCCAAAAT ATAAAAATTGGGACAACTTTGCCCCAATCAATATACAGGAACGGGACAAATTTACCCCAG TTCATATTTTCCCAAAAAAAAGGGGGCTAACAAGGTTCACAAAATAGAGGGGGGGTGGGG GAAAAAACTTTTCCCCAATTAAG |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
41-200, - strand, RNAz p=0.794902 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
41-200, - strand, RNAz p=0.794902 |
Homologous human UTR: 1 entry(ies) | More info |
Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
5' of NM_001731, - |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
2-203, gnl|bosTau2|chr5 (14037865-14038066) | |
2-203, gnl|Hg17|chr12 (91039371-91039572) | |
2-203, gnl|Mm7|chr10 (96182112-96181911) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
2-203, gnl|bosTau2|chr5 (14037865-14038066) | |
2-203, gnl|Hg17|chr12 (91039371-91039572) | |
2-203, gnl|Mm7|chr10 (96182112-96181911) |