Lym1-jns85_A10.f
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGATTTAAGGATGACTTTTATATTTAAAATTAACCAGCTGGACTCAATTTAAATGATCCC AATTTTGGTAGCAACATTCAAAGCATTATAATCAGGAGCTAGTCGAACATATGCC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGATTTAAGGATGACTTTTATATTTAAAATTAACCAGCTGGACTCAATTTAAATGATCCC AATTTTGGTAGCAACATTCAAAGCATTATAATCAGGAGCTAGTCGAACATATGCC |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 3-115, gnl|bosTau2|chr14 (40215038-40215150) | |
| 3-115, gnl|Hg17|chr3 (162629574-162629683) | |
| 3-115, gnl|Mm7|chr14 (31603791-31603678) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-115, gnl|bosTau2|chr14 (40215038-40215150) | |
| 3-115, gnl|Hg17|chr3 (162629574-162629683) | |
| 3-115, gnl|Mm7|chr14 (31603791-31603678) |