Lym2-sn60_D09.f
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TGGTGCTGCCCGTGCTGCTGCTGCTCCTGGTGCTGGCTGTGGGCCTCGCCGTCTTCTTCT TCCGACGCCACGGGACCCCCAAGCGACTGCTCTATTGCCAGCGCTCCCTGCTGGACAAGG TCTGACCCCCACTGCCGCCCGCCCACTCCTACCACGAGAACTTTGTCTCTGAAGGCCAGT GGCAGCAGGTGGTGGTGGGTGGGCT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TGGTGCTGCCCGTGCTGCTGCTGCTCCTGGTGCTGGCTGTGGGCCTCGCCGTCTTCTTCT TCCGACGCCACGGGACCCCCAAGCGACTGCTCTATTGCCAGCGCTCCCTGCTGGACAAGG TCTGACCCCCACTGCCGCCCGCCCACTCCTACCACGAGAACTTTGTCTCTGAAGGCCAGT GGCAGCAGGTGGTGGTGGGTGGGCT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 88-205, + strand, RNAz p=0.683671 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 88-205, + strand, RNAz p=0.683671 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_004995, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-205, gnl|bosTau2|chr10 (14160440-14160236) | |
| 1-205, gnl|Hg17|chr14 (22384964-22385169) | |
| 1-205, gnl|Mm7|chr14 (49307623-49307828) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-205, gnl|bosTau2|chr10 (14160440-14160236) | |
| 1-205, gnl|Hg17|chr14 (22384964-22385169) | |
| 1-205, gnl|Mm7|chr14 (49307623-49307828) |