Non-Coding RNA Search

Lym2-sn77_H01.f1

Sequence:


               
               GAAAATCCAACTTTGACCTTTATTCAAAAAACACAAATGGGTTGCCCCAAGATCCGGGTG
CCAACCCTGAGGCCAAACAAGGGTGGAAACCCACAATTTGGCCCTGCTTTGCCCTGAGCT
GCAACCTTAACCCCAAGATCCTGCCTGCAACCACTGAGGGGCGGGCGGAGGGAACCCTGG
GGGGGTGGGAACTTCTTTTGTTTCTTT

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GAAAATCCAACTTTGACCTTTATTCAAAAAACACAAATGGGTTGCCCCAAGATCCGGGTG
CCAACCCTGAGGCCAAACAAGGGTGGAAACCCACAATTTGGCCCTGCTTTGCCCTGAGCT
GCAACCTTAACCCCAAGATCCTGCCTGCAACCACTGAGGGGCGGGCGGAGGGAACCCTGG
GGGGGTGGGAACTTCTTTTGTTTCTTT

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               4-161, + strand, RNAz p=0.989317
               

               
               108-204, - strand, RNAz p=0.939957

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               4-161, + strand, RNAz p=0.989317
               

               
               108-204, - strand, RNAz p=0.939957

Predicted microRNA(s): 3 entry(ies)

More info

Predicted microRNA(s): 3 entry(ies)

Help | Less info


               
               41-194, - strand, RNAmicro p=0.999834
               

               
               49-198, + strand, RNAmicro p=0.960128
               

               
               174-299, - strand, RNAmicro p=0.945961

Predicted microRNA(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               41-194, - strand, RNAmicro p=0.999834
               

               
               49-198, + strand, RNAmicro p=0.960128
               

               
               174-299, - strand, RNAmicro p=0.945961

Homologous human UTR: 2 entry(ies)

More info

Homologous human UTR: 2 entry(ies)

Help | Less info


               
               3' of NM_004584, +
               

               
               5' of CR595463, -

Homologous human UTR: 2 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of NM_004584, +
               

               
               5' of CR595463, -

Aligned organism(s): 13 entry(ies)

More info

Aligned organism(s): 13 entry(ies)

Help | Less info


               
               4-204, gnl|bosTau2|chr29 (39768877-39768677)
               

               
               4-204, gnl|canFam2|chr18 (53091461-53091154)
               

               
               4-204, gnl|dasNov1|scaffold_23134 (45068-45353)
               

               
               4-204, gnl|echTel1|scaffold_323587 (3153-2848)
               

               
               4-204, gnl|hg17|chr11 (66922234-66922556)
               

               
               4-204, gnl|Hg17|chr11 (66922233-66922434)
               

               
               4-204, gnl|loxAfr1|scaffold_76970 (34260-33951)
               

               
               4-204, gnl|mm7|chr19 (4090223-4089927)
               

               
               4-204, gnl|Mm7|chr19 (4090222-4090029)
               

               
               4-204, gnl|monDom2|scaffold_107 (1706535-1706196)
               

               
               4-204, gnl|oryCun1|scaffold_62880 (446-159)
               

               
               4-204, gnl|rheMac2|chr14 (7063481-7063158)
               

               
               4-204, gnl|rn3|chr1 (206931787-206931486)

Aligned organism(s): 13 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               4-204, gnl|bosTau2|chr29 (39768877-39768677)
               

               
               4-204, gnl|canFam2|chr18 (53091461-53091154)
               

               
               4-204, gnl|dasNov1|scaffold_23134 (45068-45353)
               

               
               4-204, gnl|echTel1|scaffold_323587 (3153-2848)
               

               
               4-204, gnl|hg17|chr11 (66922234-66922556)
               

               
               4-204, gnl|Hg17|chr11 (66922233-66922434)
               

               
               4-204, gnl|loxAfr1|scaffold_76970 (34260-33951)
               

               
               4-204, gnl|mm7|chr19 (4090223-4089927)
               

               
               4-204, gnl|Mm7|chr19 (4090222-4090029)
               

               
               4-204, gnl|monDom2|scaffold_107 (1706535-1706196)
               

               
               4-204, gnl|oryCun1|scaffold_62880 (446-159)
               

               
               4-204, gnl|rheMac2|chr14 (7063481-7063158)
               

               
               4-204, gnl|rn3|chr1 (206931787-206931486)

	4-161, + strand, RNAz p=0.989317
	108-204, - strand, RNAz p=0.939957

	41-194, - strand, RNAmicro p=0.999834
	49-198, + strand, RNAmicro p=0.960128
	174-299, - strand, RNAmicro p=0.945961

	4-204, gnl\|bosTau2\|chr29 (39768877-39768677)
	4-204, gnl\|canFam2\|chr18 (53091461-53091154)
	4-204, gnl\|dasNov1\|scaffold_23134 (45068-45353)
	4-204, gnl\|echTel1\|scaffold_323587 (3153-2848)
	4-204, gnl\|hg17\|chr11 (66922234-66922556)
	4-204, gnl\|Hg17\|chr11 (66922233-66922434)
	4-204, gnl\|loxAfr1\|scaffold_76970 (34260-33951)
	4-204, gnl\|mm7\|chr19 (4090223-4089927)
	4-204, gnl\|Mm7\|chr19 (4090222-4090029)
	4-204, gnl\|monDom2\|scaffold_107 (1706535-1706196)
	4-204, gnl\|oryCun1\|scaffold_62880 (446-159)
	4-204, gnl\|rheMac2\|chr14 (7063481-7063158)
	4-204, gnl\|rn3\|chr1 (206931787-206931486)