Mixc-0030m04
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTTTTTTTTTCTTTTCGGGAGACAAAAAACCTCCGGAAAGGCGGAGGAGAGCTCCTTTCG CCCCTTTTCGTTTCCCCGCCTCCTTCTCTCCCCCACCTTTCCCTCCTCCGGCTTTTTCCT CCCAACTCGGGGAGGTCCTTCCCG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTTTTTTTTTCTTTTCGGGAGACAAAAAACCTCCGGAAAGGCGGAGGAGAGCTCCTTTCG CCCCTTTTCGTTTCCCCGCCTCCTTCTCTCCCCCACCTTTCCCTCCTCCGGCTTTTTCCT CCCAACTCGGGGAGGTCCTTCCCG |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 4-110, - strand, RNAz p=0.999779 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 4-110, - strand, RNAz p=0.999779 |
| Similar Transcript(s): 1 entry(ies) | More info |
| Similar Transcript(s): 1 entry(ies) | Help | Less info |
| 11-110, nae01g03.y1 Dog eye eye minus lens and cornea. Unnormalized (nae) (gb|DN875766.1|), blast E-value=5e-22, identity=89% |
| Similar Transcript(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 11-110, nae01g03.y1 Dog eye eye minus lens and cornea. Unnormalized (nae) (gb|DN875766.1|), blast E-value=5e-22, identity=89% |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 4-142, gnl|bosTau2|chr15 (25624322-25624183) | |
| 4-142, gnl|Hg17|chr17 (7328577-7328713) | |
| 4-142, gnl|Mm7|chr11 (69840042-69839892) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 4-142, gnl|bosTau2|chr15 (25624322-25624183) | |
| 4-142, gnl|Hg17|chr17 (7328577-7328713) | |
| 4-142, gnl|Mm7|chr11 (69840042-69839892) |