Mus1-POSM0100010_F05F
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CCACGCGTCCGCAGTGGTGTTGGGATTCACAGAAACACGTTGCTGAAATGAAAGGGAAGA CGATGTACTTACATTGTAAAATGGTTTACAATAAAGATGACATCTTATTACAGTTTTTAA ACAAAAAAAAAAAAAAAAAAAAAAGGTTAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CCACGCGTCCGCAGTGGTGTTGGGATTCACAGAAACACGTTGCTGAAATGAAAGGGAAGA CGATGTACTTACATTGTAAAATGGTTTACAATAAAGATGACATCTTATTACAGTTTTTAA ACAAAAAAAAAAAAAAAAAAAAAAGGTTAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 14-128, + strand, RNAz p=0.695656 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 14-128, + strand, RNAz p=0.695656 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 14-128, gnl|bosTau2|chr22 (42295564-42295679) | |
| 14-128, gnl|Hg17|chr3 (52845906-52845790) | |
| 14-128, gnl|Mm7|chr14 (28307745-28307859) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 14-128, gnl|bosTau2|chr22 (42295564-42295679) | |
| 14-128, gnl|Hg17|chr3 (52845906-52845790) | |
| 14-128, gnl|Mm7|chr14 (28307745-28307859) |