Ova1-OVRM10188C05
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AGACCTGCAGCGGAGCCGCGGCGCCCGCTCGGATCGGCTCGGGGCTGTGCCCCCCTGGGA CCCGGCGGCTGGGGCCGGCGGAGACCGTCCCCGCCGGGCTGGGCCCCTCGGCACTGCCAG GTGTGGATCCATGGGGTAGTCCCCAAGCATCTGCCCCTCTGCCCCAGGCAGCTCATGCCT TAACACCCAGGGGCAGTGAACAGAGCCCTGGCTGGTGCCCAAACATGTGGGGCCTGGTGA GGCTCCTGCTGGCCTGGCTGGGTGGC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AGACCTGCAGCGGAGCCGCGGCGCCCGCTCGGATCGGCTCGGGGCTGTGCCCCCCTGGGA CCCGGCGGCTGGGGCCGGCGGAGACCGTCCCCGCCGGGCTGGGCCCCTCGGCACTGCCAG GTGTGGATCCATGGGGTAGTCCCCAAGCATCTGCCCCTCTGCCCCAGGCAGCTCATGCCT TAACACCCAGGGGCAGTGAACAGAGCCCTGGCTGGTGCCCAAACATGTGGGGCCTGGTGA GGCTCCTGCTGGCCTGGCTGGGTGGC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 118-266, + strand, RNAz p=0.740118 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 118-266, + strand, RNAz p=0.740118 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 204-285, + strand, RNAmicro p=0.960483 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of AK057922, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 118-266, gnl|bosTau2|chr10 (14003708-14003860) | |
| 118-266, gnl|Hg17|chr14 (22594909-22594741) | |
| 118-266, gnl|Mm7|chr14 (49506471-49506310) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 118-266, gnl|bosTau2|chr10 (14003708-14003860) | |
| 118-266, gnl|Hg17|chr14 (22594909-22594741) | |
| 118-266, gnl|Mm7|chr14 (49506471-49506310) |