Non-Coding RNA Search

Ova2-C0003104_C10

Sequence:


               
               GCGGCTCAGTGGCTCGGGGCAGGTGCGGCGCTATTAGCGTAGTCGGGTCCGGTCTTCTTC
AGTCCGGACACGGTCAGCAAGCGGCCGCTTCGTGGAACAGAGAGGTGCATTGCCAGGTTC
CTGATGAACCCAGAGAACCCTCCACCATATCCGGGCCCCGGGCCAACAGCCCCATACCCA
CCTTATCCACAACAGCCAATGGGGCCTATGGGAGCCCCACCTCCTCAGGGGTACCCCTAC
CCACCACCTCAGGGGTACCCCTATCAAGGATACCCACAGTACGGATGGCAGGGTGGACCT
CAGGAGCCTCCTAAGACCACAGTGTATGTGGTAGAAGACCAAAGAAGAGATGACCTGGGC
CCATCCACCTGCCTCACAGCCTGCTGGACTGCTCTGTGTTGCTGCTGCCTGTGGGACATG
CTCACCTGATCACCTGATGAGCCTAGCTCTTCTGCTTGGCCGCTCTGTGCCACTCCGATA
GGTGTGCCTGGGCCCACCTCTTCTGATTGCTGTATTGACTAACTCTGC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GCGGCTCAGTGGCTCGGGGCAGGTGCGGCGCTATTAGCGTAGTCGGGTCCGGTCTTCTTC
AGTCCGGACACGGTCAGCAAGCGGCCGCTTCGTGGAACAGAGAGGTGCATTGCCAGGTTC
CTGATGAACCCAGAGAACCCTCCACCATATCCGGGCCCCGGGCCAACAGCCCCATACCCA
CCTTATCCACAACAGCCAATGGGGCCTATGGGAGCCCCACCTCCTCAGGGGTACCCCTAC
CCACCACCTCAGGGGTACCCCTATCAAGGATACCCACAGTACGGATGGCAGGGTGGACCT
CAGGAGCCTCCTAAGACCACAGTGTATGTGGTAGAAGACCAAAGAAGAGATGACCTGGGC
CCATCCACCTGCCTCACAGCCTGCTGGACTGCTCTGTGTTGCTGCTGCCTGTGGGACATG
CTCACCTGATCACCTGATGAGCCTAGCTCTTCTGCTTGGCCGCTCTGTGCCACTCCGATA
GGTGTGCCTGGGCCCACCTCTTCTGATTGCTGTATTGACTAACTCTGC

Coded protein: 1 entry(ies)

More info

Coded protein: 1 entry(ies)

Help | Less info


               
               Q8K353_MOUSE

Coded protein: 1 entry(ies)

Help | Less info

Protein identifier


               
               Q8K353_MOUSE

Predicted RNA structure(s): 3 entry(ies)

More info

Predicted RNA structure(s): 3 entry(ies)

Help | Less info


               
               117-330, - strand, RNAz p=0.998572
               

               
               142-330, - strand, RNAz p=0.990268
               

               
               211-330, - strand, RNAz p=0.872519

Predicted RNA structure(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               117-330, - strand, RNAz p=0.998572
               

               
               142-330, - strand, RNAz p=0.990268
               

               
               211-330, - strand, RNAz p=0.872519

Predicted microRNA(s): 1 entry(ies)

More info

Predicted microRNA(s): 1 entry(ies)

Help | Less info


               
               222-322, - strand, RNAmicro p=0.950315

Predicted microRNA(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               222-322, - strand, RNAmicro p=0.950315

Similar Transcript(s): 12 entry(ies)

More info

Similar Transcript(s): 12 entry(ies)

Help | Less info


               
               117-330, BP485722 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA 
(dbj|BP485722.1|), blast E-value=0, identity=100% 
               

               
               117-330, UI-R-AA1-aaa-d-08-0-UI.s1 UI-R-AA1 Rattus norvegicus cDNA clone 
(gb|AI704789.1|), blast E-value=0, identity=100% 
               

               
               117-330, UI-R-BJ0-ael-f-04-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW252866.1|), blast E-value=0, identity=100% 
               

               
               117-330, UI-R-BJ0-adu-h-03-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW254706.1|), blast E-value=0, identity=100% 
               

               
               117-330, AMGNNUC (gb|CB582530.1|), blast E-value=0, identity=100%
               

               
               117-330, AMGNNUC (gb|CB583019.1|), blast E-value=0, identity=100%
               

               
               142-330, BP485722 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA 
(dbj|BP485722.1|), blast E-value=0, identity=100% 
               

               
               142-330, UI-R-AA1-aaa-d-08-0-UI.s1 UI-R-AA1 Rattus norvegicus cDNA clone 
(gb|AI704789.1|), blast E-value=0, identity=100% 
               

               
               142-330, UI-R-BJ0-ael-f-04-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW252866.1|), blast E-value=0, identity=100% 
               

               
               142-330, UI-R-BJ0-adu-h-03-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW254706.1|), blast E-value=0, identity=100% 
               

               
               142-330, AMGNNUC (gb|CB582530.1|), blast E-value=0, identity=100%
               

               
               142-330, AMGNNUC (gb|CB583019.1|), blast E-value=0, identity=100%

Similar Transcript(s): 12 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               117-330, BP485722 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA 
(dbj|BP485722.1|), blast E-value=0, identity=100% 
               

               
               117-330, UI-R-AA1-aaa-d-08-0-UI.s1 UI-R-AA1 Rattus norvegicus cDNA clone 
(gb|AI704789.1|), blast E-value=0, identity=100% 
               

               
               117-330, UI-R-BJ0-ael-f-04-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW252866.1|), blast E-value=0, identity=100% 
               

               
               117-330, UI-R-BJ0-adu-h-03-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW254706.1|), blast E-value=0, identity=100% 
               

               
               117-330, AMGNNUC (gb|CB582530.1|), blast E-value=0, identity=100%
               

               
               117-330, AMGNNUC (gb|CB583019.1|), blast E-value=0, identity=100%
               

               
               142-330, BP485722 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA 
(dbj|BP485722.1|), blast E-value=0, identity=100% 
               

               
               142-330, UI-R-AA1-aaa-d-08-0-UI.s1 UI-R-AA1 Rattus norvegicus cDNA clone 
(gb|AI704789.1|), blast E-value=0, identity=100% 
               

               
               142-330, UI-R-BJ0-ael-f-04-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW252866.1|), blast E-value=0, identity=100% 
               

               
               142-330, UI-R-BJ0-adu-h-03-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone 
(gb|AW254706.1|), blast E-value=0, identity=100% 
               

               
               142-330, AMGNNUC (gb|CB582530.1|), blast E-value=0, identity=100%
               

               
               142-330, AMGNNUC (gb|CB583019.1|), blast E-value=0, identity=100%

Aligned organism(s): 23 entry(ies)

More info

Aligned organism(s): 23 entry(ies)

Help | Less info


               
               117-330, gnl|bosTau2|chr7 (29464526-29464307)
               

               
               117-330, gnl|canFam2|chr15 (30084937-30085128)
               

               
               117-330, gnl|canFam2|chr2 (38257989-38258213)
               

               
               117-330, gnl|dasNov1|scaffold_10360 (27368-27163)
               

               
               117-330, gnl|dasNov1|scaffold_2983 (132630-132840)
               

               
               117-330, gnl|echTel1|scaffold_236037 (7009-6787)
               

               
               117-330, gnl|echTel1|scaffold_236037 (7009-6790)
               

               
               117-330, gnl|hg17|chr5 (139554214-139554423)
               

               
               117-330, gnl|hg17|chr5 (173839649-173839864)
               

               
               117-330, gnl|Hg17|chr5 (139554227-139554422)
               

               
               117-330, gnl|loxAfr1|scaffold_41088 (11978-12185)
               

               
               117-330, gnl|loxAfr1|scaffold_7361 (27820-27597)
               

               
               117-330, gnl|mm7|chr18 (36742615-36742844)
               

               
               117-330, gnl|mm7|chr18 (36742615-36742840)
               

               
               117-330, gnl|Mm7|chr18 (36742628-36742845)
               

               
               117-330, gnl|monDom2|scaffold_17 (48371874-48371658)
               

               
               117-330, gnl|monDom2|scaffold_6 (68616447-68616212)
               

               
               117-330, gnl|panTro1|chr4 (146170675-146170884)
               

               
               117-330, gnl|panTro1|chr4 (181233580-181233794)
               

               
               117-330, gnl|rheMac2|chr6 (136612073-136612282)
               

               
               117-330, gnl|rheMac2|chr6 (170900026-170900233)
               

               
               117-330, gnl|rn3|chr18 (29028682-29028902)
               

               
               117-330, gnl|rn3|chr2 (142596233-142596422)

Aligned organism(s): 23 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               117-330, gnl|bosTau2|chr7 (29464526-29464307)
               

               
               117-330, gnl|canFam2|chr15 (30084937-30085128)
               

               
               117-330, gnl|canFam2|chr2 (38257989-38258213)
               

               
               117-330, gnl|dasNov1|scaffold_10360 (27368-27163)
               

               
               117-330, gnl|dasNov1|scaffold_2983 (132630-132840)
               

               
               117-330, gnl|echTel1|scaffold_236037 (7009-6787)
               

               
               117-330, gnl|echTel1|scaffold_236037 (7009-6790)
               

               
               117-330, gnl|hg17|chr5 (139554214-139554423)
               

               
               117-330, gnl|hg17|chr5 (173839649-173839864)
               

               
               117-330, gnl|Hg17|chr5 (139554227-139554422)
               

               
               117-330, gnl|loxAfr1|scaffold_41088 (11978-12185)
               

               
               117-330, gnl|loxAfr1|scaffold_7361 (27820-27597)
               

               
               117-330, gnl|mm7|chr18 (36742615-36742844)
               

               
               117-330, gnl|mm7|chr18 (36742615-36742840)
               

               
               117-330, gnl|Mm7|chr18 (36742628-36742845)
               

               
               117-330, gnl|monDom2|scaffold_17 (48371874-48371658)
               

               
               117-330, gnl|monDom2|scaffold_6 (68616447-68616212)
               

               
               117-330, gnl|panTro1|chr4 (146170675-146170884)
               

               
               117-330, gnl|panTro1|chr4 (181233580-181233794)
               

               
               117-330, gnl|rheMac2|chr6 (136612073-136612282)
               

               
               117-330, gnl|rheMac2|chr6 (170900026-170900233)
               

               
               117-330, gnl|rn3|chr18 (29028682-29028902)
               

               
               117-330, gnl|rn3|chr2 (142596233-142596422)

	117-330, - strand, RNAz p=0.998572
	142-330, - strand, RNAz p=0.990268
	211-330, - strand, RNAz p=0.872519

	117-330, BP485722 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA (dbj\|BP485722.1\|), blast E-value=0, identity=100%
	117-330, UI-R-AA1-aaa-d-08-0-UI.s1 UI-R-AA1 Rattus norvegicus cDNA clone (gb\|AI704789.1\|), blast E-value=0, identity=100%
	117-330, UI-R-BJ0-ael-f-04-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone (gb\|AW252866.1\|), blast E-value=0, identity=100%
	117-330, UI-R-BJ0-adu-h-03-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone (gb\|AW254706.1\|), blast E-value=0, identity=100%
	117-330, AMGNNUC (gb\|CB582530.1\|), blast E-value=0, identity=100%
	117-330, AMGNNUC (gb\|CB583019.1\|), blast E-value=0, identity=100%
	142-330, BP485722 Rattus norvegicus insulinoma RINm5F Rattus norvegicus cDNA (dbj\|BP485722.1\|), blast E-value=0, identity=100%
	142-330, UI-R-AA1-aaa-d-08-0-UI.s1 UI-R-AA1 Rattus norvegicus cDNA clone (gb\|AI704789.1\|), blast E-value=0, identity=100%
	142-330, UI-R-BJ0-ael-f-04-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone (gb\|AW252866.1\|), blast E-value=0, identity=100%
	142-330, UI-R-BJ0-adu-h-03-0-UI.s1 UI-R-BJ0 Rattus norvegicus cDNA clone (gb\|AW254706.1\|), blast E-value=0, identity=100%
	142-330, AMGNNUC (gb\|CB582530.1\|), blast E-value=0, identity=100%
	142-330, AMGNNUC (gb\|CB583019.1\|), blast E-value=0, identity=100%

	117-330, gnl\|bosTau2\|chr7 (29464526-29464307)
	117-330, gnl\|canFam2\|chr15 (30084937-30085128)
	117-330, gnl\|canFam2\|chr2 (38257989-38258213)
	117-330, gnl\|dasNov1\|scaffold_10360 (27368-27163)
	117-330, gnl\|dasNov1\|scaffold_2983 (132630-132840)
	117-330, gnl\|echTel1\|scaffold_236037 (7009-6787)
	117-330, gnl\|echTel1\|scaffold_236037 (7009-6790)
	117-330, gnl\|hg17\|chr5 (139554214-139554423)
	117-330, gnl\|hg17\|chr5 (173839649-173839864)
	117-330, gnl\|Hg17\|chr5 (139554227-139554422)
	117-330, gnl\|loxAfr1\|scaffold_41088 (11978-12185)
	117-330, gnl\|loxAfr1\|scaffold_7361 (27820-27597)
	117-330, gnl\|mm7\|chr18 (36742615-36742844)
	117-330, gnl\|mm7\|chr18 (36742615-36742840)
	117-330, gnl\|Mm7\|chr18 (36742628-36742845)
	117-330, gnl\|monDom2\|scaffold_17 (48371874-48371658)
	117-330, gnl\|monDom2\|scaffold_6 (68616447-68616212)
	117-330, gnl\|panTro1\|chr4 (146170675-146170884)
	117-330, gnl\|panTro1\|chr4 (181233580-181233794)
	117-330, gnl\|rheMac2\|chr6 (136612073-136612282)
	117-330, gnl\|rheMac2\|chr6 (170900026-170900233)
	117-330, gnl\|rn3\|chr18 (29028682-29028902)
	117-330, gnl\|rn3\|chr2 (142596233-142596422)