Non-Coding RNA Search

Ova2-C0003105_B12

Sequence:


               
               CTTCTTTTCGCCAGGCCTTCCCCAATACCAACCGATGGTTCCTTACCTGCATTAACCAGC
CCCAGTTCAGGGCCATCTTGGGGGAGGTGAAGCTGTGTGAAAAGATGGCTCAGTTTGATG
CTAAGAAGTTCGCAGAGAGCCAGCCAAAAAAGGATACCCCGAGGAAAGAAAAGGGCTCAC
GAGAAGAGAAGCAGAAGCCCCAGACTGAGCGGAAAGAGGAAAAAAAGGCAGCTGCCCCAG
CTCCTGAGGAAGAGATGGATGAGTGTGAGCAGGCATTGGCTGCTGAGCCCAAGGCCAAGG
ACCCTTTCGCTCACCTGCCCAAAAGTACCTTTGTGTTGGATGAGTTTAAGCGAAAGTACT
CCAATGAGGACACCCTCTCTGTGGCGCTGCCATATTTTTGGGAGCATTTTGATAAGGATG
GC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CTTCTTTTCGCCAGGCCTTCCCCAATACCAACCGATGGTTCCTTACCTGCATTAACCAGC
CCCAGTTCAGGGCCATCTTGGGGGAGGTGAAGCTGTGTGAAAAGATGGCTCAGTTTGATG
CTAAGAAGTTCGCAGAGAGCCAGCCAAAAAAGGATACCCCGAGGAAAGAAAAGGGCTCAC
GAGAAGAGAAGCAGAAGCCCCAGACTGAGCGGAAAGAGGAAAAAAAGGCAGCTGCCCCAG
CTCCTGAGGAAGAGATGGATGAGTGTGAGCAGGCATTGGCTGCTGAGCCCAAGGCCAAGG
ACCCTTTCGCTCACCTGCCCAAAAGTACCTTTGTGTTGGATGAGTTTAAGCGAAAGTACT
CCAATGAGGACACCCTCTCTGTGGCGCTGCCATATTTTTGGGAGCATTTTGATAAGGATG
GC

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               1-119, - strand, RNAz p=0.657436
               

               
               200-317, - strand, RNAz p=0.96542

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-119, - strand, RNAz p=0.657436
               

               
               200-317, - strand, RNAz p=0.96542

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               200-317, AGENCOURT_50143264 NCI_CGAP_Pr50 Rattus norvegicus cDNA clone 
(gb|DN936499.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, LRAGE054190 Liver regeneration after partial hepatectomy Rattus 
(gb|DW291362.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, LRAGE089807 Liver regeneration after partial hepatectomy Rattus 
(gb|DW329979.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, LRAGE018782 Liver regeneration after partial hepatectomy Rattus 
(gb|DW373199.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, AGENCOURT_66960774 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY309299.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, AGENCOURT_67839270 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY316302.1|), blast E-value=0, identity=94.07%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               200-317, AGENCOURT_50143264 NCI_CGAP_Pr50 Rattus norvegicus cDNA clone 
(gb|DN936499.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, LRAGE054190 Liver regeneration after partial hepatectomy Rattus 
(gb|DW291362.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, LRAGE089807 Liver regeneration after partial hepatectomy Rattus 
(gb|DW329979.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, LRAGE018782 Liver regeneration after partial hepatectomy Rattus 
(gb|DW373199.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, AGENCOURT_66960774 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY309299.1|), blast E-value=0, identity=94.07% 
               

               
               200-317, AGENCOURT_67839270 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY316302.1|), blast E-value=0, identity=94.07%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-421, gnl|bosTau2|chr26 (31048676-31049095)
               

               
               1-421, gnl|Hg17|chr7 (132177403-132176991)
               

               
               1-421, gnl|Mm7|chr7 (112747852-112747443)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-421, gnl|bosTau2|chr26 (31048676-31049095)
               

               
               1-421, gnl|Hg17|chr7 (132177403-132176991)
               

               
               1-421, gnl|Mm7|chr7 (112747852-112747443)

	1-119, - strand, RNAz p=0.657436
	200-317, - strand, RNAz p=0.96542

	200-317, AGENCOURT_50143264 NCI_CGAP_Pr50 Rattus norvegicus cDNA clone (gb\|DN936499.1\|), blast E-value=0, identity=94.07%
	200-317, LRAGE054190 Liver regeneration after partial hepatectomy Rattus (gb\|DW291362.1\|), blast E-value=0, identity=94.07%
	200-317, LRAGE089807 Liver regeneration after partial hepatectomy Rattus (gb\|DW329979.1\|), blast E-value=0, identity=94.07%
	200-317, LRAGE018782 Liver regeneration after partial hepatectomy Rattus (gb\|DW373199.1\|), blast E-value=0, identity=94.07%
	200-317, AGENCOURT_66960774 NIH_MGC_367 Rattus norvegicus cDNA clone (gb\|DY309299.1\|), blast E-value=0, identity=94.07%
	200-317, AGENCOURT_67839270 NIH_MGC_367 Rattus norvegicus cDNA clone (gb\|DY316302.1\|), blast E-value=0, identity=94.07%

	1-421, gnl\|bosTau2\|chr26 (31048676-31049095)
	1-421, gnl\|Hg17\|chr7 (132177403-132176991)
	1-421, gnl\|Mm7\|chr7 (112747852-112747443)