Ova2-C0003264_F20
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GAAAGCTCATGAGGAGCCGCCTGCCAAGTTGCTGGATGACCTCTTCCGTAAGACCAAGGC AGCTCCCTGCATCTATTGACTCCCACTGACTGAGAGCCAGATTGTTCAGAAGGAGGCTCA TCAAGTATAACGGGCCAAGGATCGGGAGAAGCGGCGAATGGAACGAGAAGAAG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GAAAGCTCATGAGGAGCCGCCTGCCAAGTTGCTGGATGACCTCTTCCGTAAGACCAAGGC AGCTCCCTGCATCTATTGACTCCCACTGACTGAGAGCCAGATTGTTCAGAAGGAGGCTCA TCAAGTATAACGGGCCAAGGATCGGGAGAAGCGGCGAATGGAACGAGAAGAAG |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-100, - strand, RNAz p=0.719953 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-100, - strand, RNAz p=0.719953 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-100, gnl|bosTau2|chr10 (13999365-13999465) | |
| 1-100, gnl|Hg17|chr14 (22600232-22600133) | |
| 1-100, gnl|Mm7|chr14 (49510630-49510531) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-100, gnl|bosTau2|chr10 (13999365-13999465) | |
| 1-100, gnl|Hg17|chr14 (22600232-22600133) | |
| 1-100, gnl|Mm7|chr14 (49510630-49510531) |