Non-Coding RNA Search

Ova2-C0003265_P03

Sequence:


               
               TCTAGATCGCGACTGGAGTTTTTTTTTTTTTTTTTTTGGGGCACAAAATAACTGGTGTCT
TTGTAAATGTTGTTTTACTTTTTTTTTTGTTTTTGTTTTTTTTAAATATAAGACTAGTCT
TTAAAAGATGTACTGTTCCTTTTTGTTTTTTTGTTGTTTGTTTTGTTTTTTTGTTTGTTT
TTCCCCCTTTTTGTACTGAGCTCAGTTAGACTAATACTATAATGTTAAAAACTGGAATTT
CCTCTAGCATTTTGCTTAAAAGCAATATGCTATTTGCTTATTTCGTGCCCTGGCATACTT
TTTGAATTCCGATAGAATACAAGTGTGGTATATGCCATGTTTGTACTATCTAACAACTTC
TCTTCCAGTAGTCTTGTTTATACCATGTGGTTGTTTGTGTGTCACTTTTCCCTTTCTCTC
CTTAACATAATTGTCTTGTGTTAAGGATCTCAAAGATTTCATG

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               TCTAGATCGCGACTGGAGTTTTTTTTTTTTTTTTTTTGGGGCACAAAATAACTGGTGTCT
TTGTAAATGTTGTTTTACTTTTTTTTTTGTTTTTGTTTTTTTTAAATATAAGACTAGTCT
TTAAAAGATGTACTGTTCCTTTTTGTTTTTTTGTTGTTTGTTTTGTTTTTTTGTTTGTTT
TTCCCCCTTTTTGTACTGAGCTCAGTTAGACTAATACTATAATGTTAAAAACTGGAATTT
CCTCTAGCATTTTGCTTAAAAGCAATATGCTATTTGCTTATTTCGTGCCCTGGCATACTT
TTTGAATTCCGATAGAATACAAGTGTGGTATATGCCATGTTTGTACTATCTAACAACTTC
TCTTCCAGTAGTCTTGTTTATACCATGTGGTTGTTTGTGTGTCACTTTTCCCTTTCTCTC
CTTAACATAATTGTCTTGTGTTAAGGATCTCAAAGATTTCATG

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               101-400, - strand, RNAz p=0.999521

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               101-400, - strand, RNAz p=0.999521

Predicted microRNA(s): 1 entry(ies)

More info

Predicted microRNA(s): 1 entry(ies)

Help | Less info


               
               226-301, + strand, RNAmicro p=0.901918

Predicted microRNA(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               226-301, + strand, RNAmicro p=0.901918

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               193-139, AGENCOURT_31522600 NIH_MGC_269 Rattus norvegicus cDNA clone 
(gb|CV109131.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-139, AGENCOURT_31538517 NIH_MGC_270 Rattus norvegicus cDNA clone 
(gb|CV112453.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-139, RVL9496 Wackym-Soares normalized rat vestibular cDNA library Rattus 
(gb|DV718851.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-400, RVL19358 Wackym-Soares normalized rat vestibular cDNA library 
(gb|DV726950.1|), blast E-value=0, identity=100% 
               

               
               193-139, AGENCOURT_66933172 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY310630.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-139, AGENCOURT_66960030 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY315319.1|), blast E-value=0.00000000002, identity=100%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               193-139, AGENCOURT_31522600 NIH_MGC_269 Rattus norvegicus cDNA clone 
(gb|CV109131.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-139, AGENCOURT_31538517 NIH_MGC_270 Rattus norvegicus cDNA clone 
(gb|CV112453.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-139, RVL9496 Wackym-Soares normalized rat vestibular cDNA library Rattus 
(gb|DV718851.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-400, RVL19358 Wackym-Soares normalized rat vestibular cDNA library 
(gb|DV726950.1|), blast E-value=0, identity=100% 
               

               
               193-139, AGENCOURT_66933172 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY310630.1|), blast E-value=0.00000000002, identity=100% 
               

               
               193-139, AGENCOURT_66960030 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY315319.1|), blast E-value=0.00000000002, identity=100%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               22-463, gnl|bosTau2|chr10 (55862199-55861765)
               

               
               22-463, gnl|Hg17|chr14 (69306524-69306954)
               

               
               22-463, gnl|Mm7|chr12 (78911460-78911898)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               22-463, gnl|bosTau2|chr10 (55862199-55861765)
               

               
               22-463, gnl|Hg17|chr14 (69306524-69306954)
               

               
               22-463, gnl|Mm7|chr12 (78911460-78911898)

	193-139, AGENCOURT_31522600 NIH_MGC_269 Rattus norvegicus cDNA clone (gb\|CV109131.1\|), blast E-value=0.00000000002, identity=100%
	193-139, AGENCOURT_31538517 NIH_MGC_270 Rattus norvegicus cDNA clone (gb\|CV112453.1\|), blast E-value=0.00000000002, identity=100%
	193-139, RVL9496 Wackym-Soares normalized rat vestibular cDNA library Rattus (gb\|DV718851.1\|), blast E-value=0.00000000002, identity=100%
	193-400, RVL19358 Wackym-Soares normalized rat vestibular cDNA library (gb\|DV726950.1\|), blast E-value=0, identity=100%
	193-139, AGENCOURT_66933172 NIH_MGC_367 Rattus norvegicus cDNA clone (gb\|DY310630.1\|), blast E-value=0.00000000002, identity=100%
	193-139, AGENCOURT_66960030 NIH_MGC_367 Rattus norvegicus cDNA clone (gb\|DY315319.1\|), blast E-value=0.00000000002, identity=100%

	22-463, gnl\|bosTau2\|chr10 (55862199-55861765)
	22-463, gnl\|Hg17\|chr14 (69306524-69306954)
	22-463, gnl\|Mm7\|chr12 (78911460-78911898)