Pig1-113O12
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CAAGAGTGGCTTACGCGAACTTGAGACCCTTTGAGCCAGTTGAAGAGTCGAGTCCTTCAA ACACAGAGTCTTCAAATCCTAATCCTCCTGAGCCAAATTCGGACCCTGTCCACTCAGAGT TCTGAGGGAGGCCAGATGTTGGGGAGAGATGTAGGAGCTGCCAGTCACAGGGCCATTACC TATGCAGTGGACATTTGAAAACATTTTCAGATTTTTTAAAATATTT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAAGAGTGGCTTACGCGAACTTGAGACCCTTTGAGCCAGTTGAAGAGTCGAGTCCTTCAA ACACAGAGTCTTCAAATCCTAATCCTCCTGAGCCAAATTCGGACCCTGTCCACTCAGAGT TCTGAGGGAGGCCAGATGTTGGGGAGAGATGTAGGAGCTGCCAGTCACAGGGCCATTACC TATGCAGTGGACATTTGAAAACATTTTCAGATTTTTTAAAATATTT |
| Coded protein: 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 107-217, + strand, RNAz p=0.730018 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 107-217, + strand, RNAz p=0.730018 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-217, gnl|bosTau2|chr11 (34587085-34587305) | |
| 1-217, gnl|Hg17|chr2 (85688840-85688618) | |
| 1-217, gnl|Mm7|chr6 (72447965-72448172) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-217, gnl|bosTau2|chr11 (34587085-34587305) | |
| 1-217, gnl|Hg17|chr2 (85688840-85688618) | |
| 1-217, gnl|Mm7|chr6 (72447965-72448172) |