Pig1-130A10
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TCCCATCACACGACATCTTACTGGGCATGTGCCTGGAGGTGCTGGGCGTGCGGCCCACGG CCCACGAGGGCTTCAAGACATTCGGCATCTCGAGGAACCGCAACAGCCGCATGAACAAGG AGCCCTGCTTTTTCCGCTCCATGCT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TCCCATCACACGACATCTTACTGGGCATGTGCCTGGAGGTGCTGGGCGTGCGGCCCACGG CCCACGAGGGCTTCAAGACATTCGGCATCTCGAGGAACCGCAACAGCCGCATGAACAAGG AGCCCTGCTTTTTCCGCTCCATGCT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 26-145, + strand, RNAz p=0.523122 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 26-145, + strand, RNAz p=0.523122 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 24-108, + strand, RNAmicro p=0.985113 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 2-145, gnl|bosTau2|chr2 (71482348-71482490) | |
| 2-145, gnl|Hg17|chr2 (232088905-232089047) | |
| 2-145, gnl|Mm7|chr1 (86206667-86206809) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 2-145, gnl|bosTau2|chr2 (71482348-71482490) | |
| 2-145, gnl|Hg17|chr2 (232088905-232089047) | |
| 2-145, gnl|Mm7|chr1 (86206667-86206809) |