Pig1-132I02
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CGCCGCTTCCCCCAGGACTTGCCCGGGGACTCCAGCCCGCCTGGCCGGCAGCGTCTGTGC CGCCAGCCTCTGGCTCGAGCATTATGGGGAGCCAGGAGCCCCAAACGGCCGTAAACTGCA GCCCCTTGGGGCCCCTTCGCCCTTGGAAAAAGCCTCTCGGCGGGTCCTGGCTGTGGTCCT GGAAGAGTCATGGCTGCCCACATGGTTCCCCTGGTGCCCCAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CGCCGCTTCCCCCAGGACTTGCCCGGGGACTCCAGCCCGCCTGGCCGGCAGCGTCTGTGC CGCCAGCCTCTGGCTCGAGCATTATGGGGAGCCAGGAGCCCCAAACGGCCGTAAACTGCA GCCCCTTGGGGCCCCTTCGCCCTTGGAAAAAGCCTCTCGGCGGGTCCTGGCTGTGGTCCT GGAAGAGTCATGGCTGCCCACATGGTTCCCCTGGTGCCCCAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 30-148, - strand, RNAz p=0.988803 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 30-148, - strand, RNAz p=0.988803 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 91-171, + strand, RNAmicro p=0.990546 | |
| 44-120, - strand, RNAmicro p=0.974854 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 91-171, + strand, RNAmicro p=0.990546 | |
| 44-120, - strand, RNAmicro p=0.974854 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 30-206, gnl|bosTau2|chr25 (25779447-25779271) | |
| 30-206, gnl|Hg17|chr16 (30570612-30570788) | |
| 30-206, gnl|Mm7|chr7 (123568650-123568826) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 30-206, gnl|bosTau2|chr25 (25779447-25779271) | |
| 30-206, gnl|Hg17|chr16 (30570612-30570788) | |
| 30-206, gnl|Mm7|chr7 (123568650-123568826) |