Pig1-133B10
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
CACGCGTCCGGAATAATTTTAAACATTATATCTTCTCCATGTTTTCAGGTAACAGTGTCC AAACAACGTAATTTTTAAGATTATATACAAATCACCTTAGGGAATTACTGCAAGATGCTA CTTTGCCGGCATGGCCCAGCATCTGTCTTAGTTTCTTTCCCTTCATCTTTGCTaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
CACGCGTCCGGAATAATTTTAAACATTATATCTTCTCCATGTTTTCAGGTAACAGTGTCC AAACAACGTAATTTTTAAGATTATATACAAATCACCTTAGGGAATTACTGCAAGATGCTA CTTTGCCGGCATGGCCCAGCATCTGTCTTAGTTTCTTTCCCTTCATCTTTGCTaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
94-196, - strand, RNAz p=0.948954 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
94-196, - strand, RNAz p=0.948954 |
Homologous human UTR: 1 entry(ies) | More info |
Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
3' of NM_014720, - |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
43-196, gnl|bosTau2|chr26 (17773239-17773084) | |
43-196, gnl|Hg17|chr10 (105775776-105775587) | |
43-196, gnl|Mm7|chr19 (47542893-47542714) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
43-196, gnl|bosTau2|chr26 (17773239-17773084) | |
43-196, gnl|Hg17|chr10 (105775776-105775587) | |
43-196, gnl|Mm7|chr19 (47542893-47542714) |