Pig1-14I02
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GATTTTTCTATGATAGCAGAGGACCTAGATTTATCCAAATTCCACCTGGCTTGAGTATTT TCCATATTGTGTCAATATAATCAATTACATTATGAGCTGTGTCTATGAAGAAACAGGTAG CAATACAGTCCCAGGTATTGCATTCTGAGTATATCTCCTGA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GATTTTTCTATGATAGCAGAGGACCTAGATTTATCCAAATTCCACCTGGCTTGAGTATTT TCCATATTGTGTCAATATAATCAATTACATTATGAGCTGTGTCTATGAAGAAACAGGTAG CAATACAGTCCCAGGTATTGCATTCTGAGTATATCTCCTGA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 23-138, - strand, RNAz p=0.772313 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 23-138, - strand, RNAz p=0.772313 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 23-138, gnl|bosTau2|chr8 (23678165-23678280) | |
| 23-138, gnl|Hg17|chr9 (74840915-74841030) | |
| 23-138, gnl|Mm7|chr19 (18394692-18394577) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 23-138, gnl|bosTau2|chr8 (23678165-23678280) | |
| 23-138, gnl|Hg17|chr9 (74840915-74841030) | |
| 23-138, gnl|Mm7|chr19 (18394692-18394577) |