Pig1-34C05
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GATCGCGAGGGCCGCCCTTTTTTTTTTTTTTGGTTAAATTTTTAAAATTTTTTAATTTTT TAATTAATTTTTAATTTTTTTAAAGCACGGGATCCTGTTTTCACTCCTACACACTGAACA TTTCCATTCGGATGCTTTTGAAATTACCATCAAGGCCAAAAGTAGGCTTACCCTTCATTT CCAAAAAATTATCTAAGTCTTTTAGCTTTTGGGAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GATCGCGAGGGCCGCCCTTTTTTTTTTTTTTGGTTAAATTTTTAAAATTTTTTAATTTTT TAATTAATTTTTAATTTTTTTAAAGCACGGGATCCTGTTTTCACTCCTACACACTGAACA TTTCCATTCGGATGCTTTTGAAATTACCATCAAGGCCAAAAGTAGGCTTACCCTTCATTT CCAAAAAATTATCTAAGTCTTTTAGCTTTTGGGAA |
| Coded protein: 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 95-212, - strand, RNAz p=0.713724 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 95-212, - strand, RNAz p=0.713724 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of AK131462, - |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 42-212, gnl|bosTau2|chr28 (18647666-18647839) | |
| 42-212, gnl|Hg17|chr8 (77939424-77939251) | |
| 42-212, gnl|Mm7|chr3 (5418937-5418764) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 42-212, gnl|bosTau2|chr28 (18647666-18647839) | |
| 42-212, gnl|Hg17|chr8 (77939424-77939251) | |
| 42-212, gnl|Mm7|chr3 (5418937-5418764) |