Non-Coding RNA Search

Pig1-41K11

Sequence:


               
               GGGGGGCGGGGGGAGGGGTGCCAAGGCTTCCTGCGCTTTGCACTATTGGGGCAAAAATGT
CTTAAGCAGTGGGGAACCTGCCACCCCACCTTGACCCTCAGACTGTCACAGACCCCTCCA
CACGTGCACACACGTGCACATGTGCGTGCGTACACACAAACACAC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GGGGGGCGGGGGGAGGGGTGCCAAGGCTTCCTGCGCTTTGCACTATTGGGGCAAAAATGT
CTTAAGCAGTGGGGAACCTGCCACCCCACCTTGACCCTCAGACTGTCACAGACCCCTCCA
CACGTGCACACACGTGCACATGTGCGTGCGTACACACAAACACAC

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               2-165, - strand, RNAz p=0.996524
               

               
               9-165, - strand, RNAz p=0.996174

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               2-165, - strand, RNAz p=0.996524
               

               
               9-165, - strand, RNAz p=0.996174

Predicted microRNA(s): 1 entry(ies)

More info

Predicted microRNA(s): 1 entry(ies)

Help | Less info


               
               87-164, + strand, RNAmicro p=0.972322

Predicted microRNA(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               87-164, + strand, RNAmicro p=0.972322

Aligned organism(s): 10 entry(ies)

More info

Aligned organism(s): 10 entry(ies)

Help | Less info


               
               2-165, gnl|bosTau2|chr19 (34512393-34512233)
               

               
               2-165, gnl|canFam2|chr9 (25799051-25798874)
               

               
               2-165, gnl|hg17|chr17 (35500844-35501023)
               

               
               2-165, gnl|Hg17|chr17 (35500895-35501056)
               

               
               2-165, gnl|mm7|chr11 (98875237-98875415)
               

               
               2-165, gnl|Mm7|chr11 (98875289-98875474)
               

               
               2-165, gnl|monDom2|scaffold_18 (49316005-49316194)
               

               
               2-165, gnl|panTro1|chr19 (38740036-38740215)
               

               
               2-165, gnl|rheMac2|chr16 (50195867-50196046)
               

               
               2-165, gnl|rn3|chr1 (209746716-209746888)

Aligned organism(s): 10 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               2-165, gnl|bosTau2|chr19 (34512393-34512233)
               

               
               2-165, gnl|canFam2|chr9 (25799051-25798874)
               

               
               2-165, gnl|hg17|chr17 (35500844-35501023)
               

               
               2-165, gnl|Hg17|chr17 (35500895-35501056)
               

               
               2-165, gnl|mm7|chr11 (98875237-98875415)
               

               
               2-165, gnl|Mm7|chr11 (98875289-98875474)
               

               
               2-165, gnl|monDom2|scaffold_18 (49316005-49316194)
               

               
               2-165, gnl|panTro1|chr19 (38740036-38740215)
               

               
               2-165, gnl|rheMac2|chr16 (50195867-50196046)
               

               
               2-165, gnl|rn3|chr1 (209746716-209746888)

	2-165, - strand, RNAz p=0.996524
	9-165, - strand, RNAz p=0.996174

	2-165, gnl\|bosTau2\|chr19 (34512393-34512233)
	2-165, gnl\|canFam2\|chr9 (25799051-25798874)
	2-165, gnl\|hg17\|chr17 (35500844-35501023)
	2-165, gnl\|Hg17\|chr17 (35500895-35501056)
	2-165, gnl\|mm7\|chr11 (98875237-98875415)
	2-165, gnl\|Mm7\|chr11 (98875289-98875474)
	2-165, gnl\|monDom2\|scaffold_18 (49316005-49316194)
	2-165, gnl\|panTro1\|chr19 (38740036-38740215)
	2-165, gnl\|rheMac2\|chr16 (50195867-50196046)
	2-165, gnl\|rn3\|chr1 (209746716-209746888)