Pig1-59G17
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGGCTGTTGTCATTCTTTCTGCACCCCCTGCTGCTGACCAGTTTATCTACCCTCCCTTCC TTTCCCCGTCCCAACTCTGCTCTGTCCTATAGCTTTATAAAGCAGGGGCACGTGGCACTG AGGTCAGGAGCAGAAGTACACCTGCCTTAGGAGCCATTCCTTATACAACAAAAATATTAA ATATTTTTTTTCCTCCTCAAAAAAAAAAAAATTAAAAAAAAAAAAAAAAAGGAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGGCTGTTGTCATTCTTTCTGCACCCCCTGCTGCTGACCAGTTTATCTACCCTCCCTTCC TTTCCCCGTCCCAACTCTGCTCTGTCCTATAGCTTTATAAAGCAGGGGCACGTGGCACTG AGGTCAGGAGCAGAAGTACACCTGCCTTAGGAGCCATTCCTTATACAACAAAAATATTAA ATATTTTTTTTCCTCCTCAAAAAAAAAAAAATTAAAAAAAAAAAAAAAAAGGAAAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 75-205, + strand, RNAz p=0.626233 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 75-205, + strand, RNAz p=0.626233 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of BC073964, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 2-205, gnl|bosTau2|chr5 (59534733-59534527) | |
| 2-205, gnl|Hg17|chr12 (8983951-8984151) | |
| 2-205, gnl|Mm7|chr6 (122344026-122343844) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 2-205, gnl|bosTau2|chr5 (59534733-59534527) | |
| 2-205, gnl|Hg17|chr12 (8983951-8984151) | |
| 2-205, gnl|Mm7|chr6 (122344026-122343844) |