Pig1-83O22
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
GCGGCCTCCTACCCCCACGGGCAGCCCGCGATCCCCGGCTCCAGCGGGGTCCATCACCTG AGCCCCCCTGGGGGCGGACCCTCCCCGGGGCGCCATGGCCCCCTCCCACCCCCGAGCTAC AGCGCCCCACGTGCAACTGCAACAACAACAACGGCATGGGGGCCGCTCCCAAGCCCTTCC TGGGGGGCTCTGGGCCCCCCATCAAGGCGGAGCCCAAGGCTCCCTATGCC |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
GCGGCCTCCTACCCCCACGGGCAGCCCGCGATCCCCGGCTCCAGCGGGGTCCATCACCTG AGCCCCCCTGGGGGCGGACCCTCCCCGGGGCGCCATGGCCCCCTCCCACCCCCGAGCTAC AGCGCCCCACGTGCAACTGCAACAACAACAACGGCATGGGGGCCGCTCCCAAGCCCTTCC TGGGGGGCTCTGGGCCCCCCATCAAGGCGGAGCCCAAGGCTCCCTATGCC |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
80-230, - strand, RNAz p=0.968349 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
80-230, - strand, RNAz p=0.968349 |
Predicted microRNA(s): 1 entry(ies) | More info |
Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
133-210, - strand, RNAmicro p=0.986013 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-230, gnl|bosTau2|chr29 (31698717-31698944) | |
1-230, gnl|Hg17|chr11 (61290037-61290264) | |
1-230, gnl|Mm7|chr19 (9909010-9908783) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-230, gnl|bosTau2|chr29 (31698717-31698944) | |
1-230, gnl|Hg17|chr11 (61290037-61290264) | |
1-230, gnl|Mm7|chr19 (9909010-9908783) |