Non-Coding RNA Search

Pig2-113E08

Sequence:


               
               GGAAATGTGCAGTATGAGTTATAACCATCTATCTATACACACATATAGACACTCATATGT
ATATACAATATATACATACAAATGATAATAACTATACCAAAATGGGCATATTTAACACAG
TTTTAAAAAGCCAGTAGATTATGGGATAATACAATTTATTTCCACTAGGGAATGGCACAA
ATAGAGAAATGCAAAGTGTCTGGGCAGCTGAAAATCATAACTATGCTAAAAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GGAAATGTGCAGTATGAGTTATAACCATCTATCTATACACACATATAGACACTCATATGT
ATATACAATATATACATACAAATGATAATAACTATACCAAAATGGGCATATTTAACACAG
TTTTAAAAAGCCAGTAGATTATGGGATAATACAATTTATTTCCACTAGGGAATGGCACAA
ATAGAGAAATGCAAAGTGTCTGGGCAGCTGAAAATCATAACTATGCTAAAAAA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               1-158, - strand, RNAz p=0.99039

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-158, - strand, RNAz p=0.99039

Predicted microRNA(s): 1 entry(ies)

More info

Predicted microRNA(s): 1 entry(ies)

Help | Less info


               
               23-134, - strand, RNAmicro p=0.999961

Predicted microRNA(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               23-134, - strand, RNAmicro p=0.999961

Similar Transcript(s): 4 entry(ies)

More info

Similar Transcript(s): 4 entry(ies)

Help | Less info


               
               99-158, DA188363 BRAMY3 Homo sapiens cDNA clone BRAMY3009509 5', mRNA 
(dbj|DA188363.1|), blast E-value=0.00000000000001, identity=93.33% 
               

               
               99-158, DA339103 BRHIP3 Homo sapiens cDNA clone BRHIP3040811 5', mRNA 
(dbj|DA339103.1|), blast E-value=0.00000000000001, identity=93.33% 
               

               
               99-158, CR748908 Homo sapiens library (Ebert L) Homo sapiens cDNA clone 
(emb|CR748908.1|), blast E-value=0.00000000000001, identity=93.33% 
               

               
               99-158, 17000425249218 GRN_ES Homo sapiens cDNA 5', mRNA sequence 
(gb|CN266517.1|), blast E-value=0.00000000000001, identity=93.33%

Similar Transcript(s): 4 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               99-158, DA188363 BRAMY3 Homo sapiens cDNA clone BRAMY3009509 5', mRNA 
(dbj|DA188363.1|), blast E-value=0.00000000000001, identity=93.33% 
               

               
               99-158, DA339103 BRHIP3 Homo sapiens cDNA clone BRHIP3040811 5', mRNA 
(dbj|DA339103.1|), blast E-value=0.00000000000001, identity=93.33% 
               

               
               99-158, CR748908 Homo sapiens library (Ebert L) Homo sapiens cDNA clone 
(emb|CR748908.1|), blast E-value=0.00000000000001, identity=93.33% 
               

               
               99-158, 17000425249218 GRN_ES Homo sapiens cDNA 5', mRNA sequence 
(gb|CN266517.1|), blast E-value=0.00000000000001, identity=93.33%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-196, gnl|bosTau2|chr19 (14087025-14087221)
               

               
               1-196, gnl|Hg17|chr17 (24897917-24897721)
               

               
               1-196, gnl|Mm7|chr11 (77615828-77616022)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-196, gnl|bosTau2|chr19 (14087025-14087221)
               

               
               1-196, gnl|Hg17|chr17 (24897917-24897721)
               

               
               1-196, gnl|Mm7|chr11 (77615828-77616022)

	99-158, DA188363 BRAMY3 Homo sapiens cDNA clone BRAMY3009509 5', mRNA (dbj\|DA188363.1\|), blast E-value=0.00000000000001, identity=93.33%
	99-158, DA339103 BRHIP3 Homo sapiens cDNA clone BRHIP3040811 5', mRNA (dbj\|DA339103.1\|), blast E-value=0.00000000000001, identity=93.33%
	99-158, CR748908 Homo sapiens library (Ebert L) Homo sapiens cDNA clone (emb\|CR748908.1\|), blast E-value=0.00000000000001, identity=93.33%
	99-158, 17000425249218 GRN_ES Homo sapiens cDNA 5', mRNA sequence (gb\|CN266517.1\|), blast E-value=0.00000000000001, identity=93.33%

	1-196, gnl\|bosTau2\|chr19 (14087025-14087221)
	1-196, gnl\|Hg17\|chr17 (24897917-24897721)
	1-196, gnl\|Mm7\|chr11 (77615828-77616022)