Pig2-15N15
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGGGGGAAGTAAAGGGCGGGCGGTCGAAGCCCTCCCGCGCTCCCGCACCCCGAAATGGCT CGGAGGCAGGACGAGCAAAGAGGGGGCGCGCCCTTGATGGCGGAAGGCAAGTCGGACGCC GGAGGTTAAGCTCATTCTGTACCACTGGACGCATTCCTTCA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGGGGGAAGTAAAGGGCGGGCGGTCGAAGCCCTCCCGCGCTCCCGCACCCCGAAATGGCT CGGAGGCAGGACGAGCAAAGAGGGGGCGCGCCCTTGATGGCGGAAGGCAAGTCGGACGCC GGAGGTTAAGCTCATTCTGTACCACTGGACGCATTCCTTCA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 2-120, - strand, RNAz p=0.936128 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 2-120, - strand, RNAz p=0.936128 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 7-108, - strand, RNAmicro p=0.987095 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 2-161, gnl|bosTau2|chr14 (21557704-21557862) | |
| 2-161, gnl|Hg17|chr8 (75425199-75425357) | |
| 2-161, gnl|Mm7|chr1 (17334653-17334806) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 2-161, gnl|bosTau2|chr14 (21557704-21557862) | |
| 2-161, gnl|Hg17|chr8 (75425199-75425357) | |
| 2-161, gnl|Mm7|chr1 (17334653-17334806) |