Pig2-17A05
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGGCCAGGGCGACGTGCAGCCTGGCACCGTGACCCTGGTGTGCTCCAACCCGCCCTGTGA GACCCATGAGACGGGCACCACCAACACGGCCACCACCATCGTC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGGCCAGGGCGACGTGCAGCCTGGCACCGTGACCCTGGTGTGCTCCAACCCGCCCTGTGA GACCCATGAGACGGGCACCACCAACACGGCCACCACCATCGTC |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-103, gnl|bosTau2|chr7 (6332386-6332284) | |
| 1-103, gnl|Hg17|chrX (152741700-152741598) | |
| 1-103, gnl|Mm7|chrX (69337210-69337108) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-103, gnl|bosTau2|chr7 (6332386-6332284) | |
| 1-103, gnl|Hg17|chrX (152741700-152741598) | |
| 1-103, gnl|Mm7|chrX (69337210-69337108) |