Pig2-17D20
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGGGGTAGGGGGAGGAGCTGGTGGGAAGGGAATGTAGCCCGAAAACAAAGCAAGCTTTGT TTTATTGCCTTCTTTGTTTTTATCTTGTTATTTAACCTCTTTTGAATTTCAAATCACATT TGAAGGGCAGTATGGAGATTTTTAGGCTTGG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGGGGTAGGGGGAGGAGCTGGTGGGAAGGGAATGTAGCCCGAAAACAAAGCAAGCTTTGT TTTATTGCCTTCTTTGTTTTTATCTTGTTATTTAACCTCTTTTGAATTTCAAATCACATT TGAAGGGCAGTATGGAGATTTTTAGGCTTGG |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 34-151, - strand, RNAz p=0.526082 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 34-151, - strand, RNAz p=0.526082 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 3-151, gnl|bosTau2|chr5 (67395220-67395064) | |
| 3-151, gnl|Hg17|chr22 (36284027-36284183) | |
| 3-151, gnl|Mm7|chr15 (78928051-78928209) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-151, gnl|bosTau2|chr5 (67395220-67395064) | |
| 3-151, gnl|Hg17|chr22 (36284027-36284183) | |
| 3-151, gnl|Mm7|chr15 (78928051-78928209) |