Pig2-18C24
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GACCGAGGGCTCCCCCAGAGGGGGCGGNTTCGTCCCCGGCAGCCAGCAACTCTGAAGTGA AGATGACCAGCTTTGCTGAACGCAAGAAGCAGCTGGTGAAGGCCGAGGCTGAGGCAGGGT CCCCCATGGCCACCCCTGTGGCACCGGAGGCCCTGAGCTCAAAGATGAGCGAGCTCGGAG CCCGGCTAGAGGAGAAACGCCGGGCCATAGAGGCTCAGAAGCGACGGATAGAGGCCATCT TT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GACCGAGGGCTCCCCCAGAGGGGGCGGNTTCGTCCCCGGCAGCCAGCAACTCTGAAGTGA AGATGACCAGCTTTGCTGAACGCAAGAAGCAGCTGGTGAAGGCCGAGGCTGAGGCAGGGT CCCCCATGGCCACCCCTGTGGCACCGGAGGCCCTGAGCTCAAAGATGAGCGAGCTCGGAG CCCGGCTAGAGGAGAAACGCCGGGCCATAGAGGCTCAGAAGCGACGGATAGAGGCCATCT TT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 84-197, + strand, RNAz p=0.978032 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 84-197, + strand, RNAz p=0.978032 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 110-228, - strand, RNAmicro p=0.97835 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of BC035808, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 5-242, gnl|bosTau2|chr7 (12364879-12365115) | |
| 5-242, gnl|Hg17|chr19 (7583012-7583254) | |
| 5-242, gnl|Mm7|chr8 (3566526-3566768) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 5-242, gnl|bosTau2|chr7 (12364879-12365115) | |
| 5-242, gnl|Hg17|chr19 (7583012-7583254) | |
| 5-242, gnl|Mm7|chr8 (3566526-3566768) |