Pig2-31C04
| Sequence: | Distiller database | More info | 
| Sequence: | Distiller database | Help | Less info | 
| GCGAAATAATGCGGACTCCGCGCTCCGCCAGCTCTCGAGGTTCCAGCCCCAGGTCCTTGG CGATGTCACCCACGAAGGAGCCCTTCTCCAGTTCCTCTGGCACCGAGTAGCGGATCTGCC CGCATCCAGGTCTTGCACAGCGTCCCCAGAAGCGCGCACAGCAGAGCCAGTCCCCCGCGG TTTCCGAGTCTCAGGTAGAAATTGA | 
| Sequence: | Distiller database | Help | Less info | 
Blue-coloured subsequences are predicted RNA structures by RNAz
| GCGAAATAATGCGGACTCCGCGCTCCGCCAGCTCTCGAGGTTCCAGCCCCAGGTCCTTGG CGATGTCACCCACGAAGGAGCCCTTCTCCAGTTCCTCTGGCACCGAGTAGCGGATCTGCC CGCATCCAGGTCTTGCACAGCGTCCCCAGAAGCGCGCACAGCAGAGCCAGTCCCCCGCGG TTTCCGAGTCTCAGGTAGAAATTGA | 
| Coded protein: 1 entry(ies) | More info | 
| Predicted RNA structure(s): 1 entry(ies) | More info | 
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info | 
| 9-128, - strand, RNAz p=0.681722 | 
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info | 
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 9-128, - strand, RNAz p=0.681722 | 
| Aligned organism(s): 3 entry(ies) | More info | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
| 9-197, gnl|bosTau2|chr7 (35188971-35188784) | |
| 9-197, gnl|Hg17|chr5 (140703981-140703794) | |
| 9-197, gnl|Mm7|chr18 (38050884-38050706) | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 9-197, gnl|bosTau2|chr7 (35188971-35188784) | |
| 9-197, gnl|Hg17|chr5 (140703981-140703794) | |
| 9-197, gnl|Mm7|chr18 (38050884-38050706) | 
