Pig2-3C01
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CGGGGGCCTGGGGTCTCTGCGGACGCTGCTGCTGCAGGACAACGCCCTGCGGGACCTGCC CCCGTACGCCTTTGCCAGCCTGGCCAGCCTGCAGAGGCTCAACCTGCAGGGGAACCGGAT CAGCCCCTGCGGGGGGCCAGGTGAGCCT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CGGGGGCCTGGGGTCTCTGCGGACGCTGCTGCTGCAGGACAACGCCCTGCGGGACCTGCC CCCGTACGCCTTTGCCAGCCTGGCCAGCCTGCAGAGGCTCAACCTGCAGGGGAACCGGAT CAGCCCCTGCGGGGGGCCAGGTGAGCCT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 30-148, + strand, RNAz p=0.944058 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 30-148, + strand, RNAz p=0.944058 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of BC052210, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 3-148, gnl|bosTau2|chr13 (22554814-22554959) | |
| 3-148, gnl|Hg17|chr11 (76049137-76048992) | |
| 3-148, gnl|Mm7|chr7 (94531067-94531212) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-148, gnl|bosTau2|chr13 (22554814-22554959) | |
| 3-148, gnl|Hg17|chr11 (76049137-76048992) | |
| 3-148, gnl|Mm7|chr7 (94531067-94531212) |