Pig2-72O03
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CAACAACAGCAGCCGGCGGCGCCGCCACCGCCGCCGGCACCACCAGCAGCCCCCCAGCAG CCCCCGGGACCCCCGTTGCAGCCTCAGCCTCTGCAGCTTCAGCAGCAGCAGCAGCAACAG CAGCAGCAGCCACCGCATCCCCTGGGTCAGCTCGCCCAAC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAACAACAGCAGCCGGCGGCGCCGCCACCGCCGCCGGCACCACCAGCAGCCCCCCAGCAG CCCCCGGGACCCCCGTTGCAGCCTCAGCCTCTGCAGCTTCAGCAGCAGCAGCAGCAACAG CAGCAGCAGCCACCGCATCCCCTGGGTCAGCTCGCCCAAC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-112, - strand, RNAz p=0.527005 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-112, - strand, RNAz p=0.527005 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-131, gnl|bosTau2|chr3 (8951751-8951621) | |
| 1-131, gnl|Hg17|chr1 (151655423-151655263) | |
| 1-131, gnl|Mm7|chr3 (89647216-89647379) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-131, gnl|bosTau2|chr3 (8951751-8951621) | |
| 1-131, gnl|Hg17|chr1 (151655423-151655263) | |
| 1-131, gnl|Mm7|chr3 (89647216-89647379) |