Pig2-7D12b
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTACACTCCTAGATGCAGATTGCTTTGAACTTTGAAAGTGTTCAGTTTGGTTTCGTTTGT ACCGATTTAAAAAATGTTTTAATGGGGAAAATTTGGGGGAGAACCGTGGGTAGGGCCTGG TTCCTTTGCTTCTCGGGGAACTACAGGGCCTTGTCCGGAGGACCGCTCTCTGCTCCACTT TCCTGGAAGTTGCCTAAGCCTGTCCACGCCGTCCAAGCCCTGC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTACACTCCTAGATGCAGATTGCTTTGAACTTTGAAAGTGTTCAGTTTGGTTTCGTTTGT ACCGATTTAAAAAATGTTTTAATGGGGAAAATTTGGGGGAGAACCGTGGGTAGGGCCTGG TTCCTTTGCTTCTCGGGGAACTACAGGGCCTTGTCCGGAGGACCGCTCTCTGCTCCACTT TCCTGGAAGTTGCCTAAGCCTGTCCACGCCGTCCAAGCCCTGC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 76-191, + strand, RNAz p=0.628696 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 76-191, + strand, RNAz p=0.628696 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of NM_153273, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 3-223, gnl|bosTau2|chr22 (38097361-38097141) | |
| 3-223, gnl|Hg17|chr3 (49737105-49736886) | |
| 3-223, gnl|Mm7|chr9 (107780062-107780267) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-223, gnl|bosTau2|chr22 (38097361-38097141) | |
| 3-223, gnl|Hg17|chr3 (49737105-49736886) | |
| 3-223, gnl|Mm7|chr9 (107780062-107780267) |