Pig2-91F06
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AGAGGACAGAGGTGCTGTGGACCCTACTGAGCGCGGGGGAGGGCTGGCGCTCCATGCAAG CCGTCCGGATGGGGGGAAAGGAGCATCTCCTGGGGGCAGGCTGGGAAAGTCCCTTCCCTC CTGGACACCCTGCTCTGGTGCTATTCCTTGTTATATTCTGCATCAGAAAAAATACAAATA CAAATTTCAAAAAAAAAAAAAAGGGGG |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AGAGGACAGAGGTGCTGTGGACCCTACTGAGCGCGGGGGAGGGCTGGCGCTCCATGCAAG CCGTCCGGATGGGGGGAAAGGAGCATCTCCTGGGGGCAGGCTGGGAAAGTCCCTTCCCTC CTGGACACCCTGCTCTGGTGCTATTCCTTGTTATATTCTGCATCAGAAAAAATACAAATA CAAATTTCAAAAAAAAAAAAAAGGGGG |
| Predicted RNA structure(s): 3 entry(ies) | More info |
| Predicted RNA structure(s): 3 entry(ies) | Help | Less info |
| 29-154, - strand, RNAz p=0.964061 | |
| 32-132, - strand, RNAz p=0.792013 | |
| 82-189, + strand, RNAz p=0.987929 |
| Predicted RNA structure(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 29-154, - strand, RNAz p=0.964061 | |
| 32-132, - strand, RNAz p=0.792013 | |
| 82-189, + strand, RNAz p=0.987929 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 57-168, - strand, RNAmicro p=0.999856 |
| Similar Transcript(s): 6 entry(ies) | More info |
| Similar Transcript(s): 6 entry(ies) | Help | Less info |
| 29-154, 225715 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BF076205.1|), blast E-value=0, identity=99.21% | |
| 29-154, 269075 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF603532.1|), blast E-value=0, identity=99.21% | |
| 29-154, 269427 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF603828.1|), blast E-value=0, identity=99.21% | |
| 29-154, 452964 MARC 1BOV Bos taurus cDNA 5', mRNA sequence (gb|BI540042.1|), blast E-value=0, identity=99.21% | |
| 29-154, 776613 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB538616.1|), blast E-value=0, identity=99.21% | |
| 29-154, UMC-bconb_0A01-007-b09 In vivo derived blastocysts Day 8 bconb Bos (gb|CV977526.1|), blast E-value=0, identity=99.21% |
| Similar Transcript(s): 6 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 29-154, 225715 MARC 2BOV Bos taurus cDNA 5', mRNA sequence (gb|BF076205.1|), blast E-value=0, identity=99.21% | |
| 29-154, 269075 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF603532.1|), blast E-value=0, identity=99.21% | |
| 29-154, 269427 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF603828.1|), blast E-value=0, identity=99.21% | |
| 29-154, 452964 MARC 1BOV Bos taurus cDNA 5', mRNA sequence (gb|BI540042.1|), blast E-value=0, identity=99.21% | |
| 29-154, 776613 MARC 6BOV Bos taurus cDNA 3', mRNA sequence (gb|CB538616.1|), blast E-value=0, identity=99.21% | |
| 29-154, UMC-bconb_0A01-007-b09 In vivo derived blastocysts Day 8 bconb Bos (gb|CV977526.1|), blast E-value=0, identity=99.21% |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_018425, + |
| Aligned organism(s): 25 entry(ies) | More info |
| Aligned organism(s): 25 entry(ies) | Help | Less info |
| 4-189, gnl|bosTau2|chr26 (10450332-10450147) | |
| 4-189, gnl|canFam2|chr28 (13917023-13917348) | |
| 4-189, gnl|canFam2|chr28 (13917021-13917337) | |
| 4-189, gnl|dasNov1|scaffold_31067 (12458-12143) | |
| 4-189, gnl|dasNov1|scaffold_31067 (12460-12153) | |
| 4-189, gnl|echTel1|scaffold_277259 (33817-34100) | |
| 4-189, gnl|echTel1|scaffold_277259 (33815-34080) | |
| 4-189, gnl|hg17|chr10 (99423587-99423892) | |
| 4-189, gnl|Hg17|chr10 (99423660-99423864) | |
| 4-189, gnl|hg17|chr17 (48868286-48868561) | |
| 4-189, gnl|loxAfr1|scaffold_11731 (8974-8650) | |
| 4-189, gnl|loxAfr1|scaffold_11731 (8976-8672) | |
| 4-189, gnl|mm7|chr19 (42013897-42014220) | |
| 4-189, gnl|mm7|chr19 (42013895-42014209) | |
| 4-189, gnl|Mm7|chr19 (42013970-42014177) | |
| 4-189, gnl|monDom2|scaffold_14 (24793673-24793350) | |
| 4-189, gnl|monDom2|scaffold_14 (24793675-24793361) | |
| 4-189, gnl|oryCun1|scaffold_185475 (9632-9322) | |
| 4-189, gnl|oryCun1|scaffold_185475 (9634-9331) | |
| 4-189, gnl|panTro1|chr19_random (34592450-34592730) | |
| 4-189, gnl|panTro1|chr8 (101160251-101160557) | |
| 4-189, gnl|rheMac2|chr16 (37742373-37742653) | |
| 4-189, gnl|rheMac2|chr9 (97259492-97259799) | |
| 4-189, gnl|rn3|chr1 (248995236-248994930) | |
| 4-189, gnl|rn3|chr1 (248995238-248994941) |
| Aligned organism(s): 25 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 4-189, gnl|bosTau2|chr26 (10450332-10450147) | |
| 4-189, gnl|canFam2|chr28 (13917023-13917348) | |
| 4-189, gnl|canFam2|chr28 (13917021-13917337) | |
| 4-189, gnl|dasNov1|scaffold_31067 (12458-12143) | |
| 4-189, gnl|dasNov1|scaffold_31067 (12460-12153) | |
| 4-189, gnl|echTel1|scaffold_277259 (33817-34100) | |
| 4-189, gnl|echTel1|scaffold_277259 (33815-34080) | |
| 4-189, gnl|hg17|chr10 (99423587-99423892) | |
| 4-189, gnl|Hg17|chr10 (99423660-99423864) | |
| 4-189, gnl|hg17|chr17 (48868286-48868561) | |
| 4-189, gnl|loxAfr1|scaffold_11731 (8974-8650) | |
| 4-189, gnl|loxAfr1|scaffold_11731 (8976-8672) | |
| 4-189, gnl|mm7|chr19 (42013897-42014220) | |
| 4-189, gnl|mm7|chr19 (42013895-42014209) | |
| 4-189, gnl|Mm7|chr19 (42013970-42014177) | |
| 4-189, gnl|monDom2|scaffold_14 (24793673-24793350) | |
| 4-189, gnl|monDom2|scaffold_14 (24793675-24793361) | |
| 4-189, gnl|oryCun1|scaffold_185475 (9632-9322) | |
| 4-189, gnl|oryCun1|scaffold_185475 (9634-9331) | |
| 4-189, gnl|panTro1|chr19_random (34592450-34592730) | |
| 4-189, gnl|panTro1|chr8 (101160251-101160557) | |
| 4-189, gnl|rheMac2|chr16 (37742373-37742653) | |
| 4-189, gnl|rheMac2|chr9 (97259492-97259799) | |
| 4-189, gnl|rn3|chr1 (248995236-248994930) | |
| 4-189, gnl|rn3|chr1 (248995238-248994941) |