Non-Coding RNA Search

Pig3-SRG8005J22

Sequence:


               
               ATTCCTTTCCTGCTTGCACTGGGGAGAGGAGGGGTAGAAACGGGCTAGCCCTTCCTCCCC
AGTACCCCAATTAATGCATTACTGCTGAGGAGTAGGGCAGGAAGACACGCTGCTGGGGAA
AGCAGGTTCTCCACGCTAGGAGAGGTGCCCTGAAACTCGCCAGGGCCACACTCCACAGCA
TTTGGGGTCATTTTCCAGCTTGAGCACATTAAGGGTCAGGGATGGATGACCCGGGCTCAT
ACCCAACACCACCCAGCTGCCCCCCTGCCAAGGCAACTCCTGAACCCACTTTTGAGGAAA
TAAACAAATAAACCCCAAAAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               ATTCCTTTCCTGCTTGCACTGGGGAGAGGAGGGGTAGAAACGGGCTAGCCCTTCCTCCCC
AGTACCCCAATTAATGCATTACTGCTGAGGAGTAGGGCAGGAAGACACGCTGCTGGGGAA
AGCAGGTTCTCCACGCTAGGAGAGGTGCCCTGAAACTCGCCAGGGCCACACTCCACAGCA
TTTGGGGTCATTTTCCAGCTTGAGCACATTAAGGGTCAGGGATGGATGACCCGGGCTCAT
ACCCAACACCACCCAGCTGCCCCCCTGCCAAGGCAACTCCTGAACCCACTTTTGAGGAAA
TAAACAAATAAACCCCAAAAA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               1-150, + strand, RNAz p=0.999964

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-150, + strand, RNAz p=0.999964

Predicted microRNA(s): 1 entry(ies)

More info

Predicted microRNA(s): 1 entry(ies)

Help | Less info


               
               18-63, + strand, RNAmicro p=0.954229

Predicted microRNA(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               18-63, + strand, RNAmicro p=0.954229

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               1-150, AV662337 Bos taurus brain fetus Bos taurus cDNA clone E1BR030A09 
(dbj|AV662337.1|), blast E-value=0, identity=100% 
               

               
               1-150, AV662338 Bos taurus brain fetus Bos taurus cDNA clone E1BR030A09 
(dbj|AV662338.1|), blast E-value=0, identity=100% 
               

               
               1-150, CR553920 Normalized and Subtracted bovine embryonic and 
(emb|CR553920.2|), blast E-value=0, identity=100% 
               

               
               1-150, 268698 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF603234.1|), 
blast E-value=0, identity=100% 
               

               
               1-150, 289477 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF889875.1|), 
blast E-value=0, identity=100% 
               

               
               1-150, 1271031 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN526275.1|), 
blast E-value=0, identity=100%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               1-150, AV662337 Bos taurus brain fetus Bos taurus cDNA clone E1BR030A09 
(dbj|AV662337.1|), blast E-value=0, identity=100% 
               

               
               1-150, AV662338 Bos taurus brain fetus Bos taurus cDNA clone E1BR030A09 
(dbj|AV662338.1|), blast E-value=0, identity=100% 
               

               
               1-150, CR553920 Normalized and Subtracted bovine embryonic and 
(emb|CR553920.2|), blast E-value=0, identity=100% 
               

               
               1-150, 268698 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF603234.1|), 
blast E-value=0, identity=100% 
               

               
               1-150, 289477 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb|BF889875.1|), 
blast E-value=0, identity=100% 
               

               
               1-150, 1271031 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN526275.1|), 
blast E-value=0, identity=100%

Aligned organism(s): 2 entry(ies)

More info

Aligned organism(s): 2 entry(ies)

Help | Less info


               
               1-317, gnl|bosTau2|chr11 (78276271-78276587)
               

               
               1-317, gnl|Hg17|chr9 (128233520-128233838)

Aligned organism(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-317, gnl|bosTau2|chr11 (78276271-78276587)
               

               
               1-317, gnl|Hg17|chr9 (128233520-128233838)

	1-150, AV662337 Bos taurus brain fetus Bos taurus cDNA clone E1BR030A09 (dbj\|AV662337.1\|), blast E-value=0, identity=100%
	1-150, AV662338 Bos taurus brain fetus Bos taurus cDNA clone E1BR030A09 (dbj\|AV662338.1\|), blast E-value=0, identity=100%
	1-150, CR553920 Normalized and Subtracted bovine embryonic and (emb\|CR553920.2\|), blast E-value=0, identity=100%
	1-150, 268698 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb\|BF603234.1\|), blast E-value=0, identity=100%
	1-150, 289477 MARC 3BOV Bos taurus cDNA 5', mRNA sequence (gb\|BF889875.1\|), blast E-value=0, identity=100%
	1-150, 1271031 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb\|DN526275.1\|), blast E-value=0, identity=100%

	1-317, gnl\|bosTau2\|chr11 (78276271-78276587)
	1-317, gnl\|Hg17\|chr9 (128233520-128233838)