Pla1-C0000937_C04
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTTTGCAGTCACTTGGTGATCCACTTTACTATGGTAAAATACAGCCATGTAAAGAAGATG AAGAAAGTGACAGTCAGATATCTCCATCCCAGTGAGTTCTGTTAAATACTTGTGATTGAC AAAAGAAGCCATCAGAATTTACTTATATCTCCTTTGAAAGATATGCCTGTAATACCCTAC TTGGTATAGTTATGTATTGCTAC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTTTGCAGTCACTTGGTGATCCACTTTACTATGGTAAAATACAGCCATGTAAAGAAGATG AAGAAAGTGACAGTCAGATATCTCCATCCCAGTGAGTTCTGTTAAATACTTGTGATTGAC AAAAGAAGCCATCAGAATTTACTTATATCTCCTTTGAAAGATATGCCTGTAATACCCTAC TTGGTATAGTTATGTATTGCTAC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-118, - strand, RNAz p=0.695201 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-118, - strand, RNAz p=0.695201 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 25-131, - strand, RNAmicro p=0.99869 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-141, gnl|bosTau2|chr12 (14826099-14825958) | |
| 1-141, gnl|Hg17|chr13 (36500375-36500228) | |
| 1-141, gnl|Mm7|chr3 (54841368-54841505) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-141, gnl|bosTau2|chr12 (14826099-14825958) | |
| 1-141, gnl|Hg17|chr13 (36500375-36500228) | |
| 1-141, gnl|Mm7|chr3 (54841368-54841505) |