Ss1.1-Liv1-LVRM10077B10.5
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
GGAGGCGGCGGCGGCGGCTGTGGGCAGTGCGCGGGGTGCAGGCGGTCGCCGTCGGGGCTC AGGCGGCGGGCAGTGGGCGCAGGCTCCCCGGTGCCCGCCCCTCCGCGGGGGGGGGGCGCG |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
GGAGGCGGCGGCGGCGGCTGTGGGCAGTGCGCGGGGTGCAGGCGGTCGCCGTCGGGGCTC AGGCGGCGGGCAGTGGGCGCAGGCTCCCCGGTGCCCGCCCCTCCGCGGGGGGGGGGCGCG |
Aligned organism(s): 2 entry(ies) | More info |
Aligned organism(s): 2 entry(ies) | Help | Less info |
1-120, gnl|bosTau2|chr28 (27696157-27696039) | |
1-120, gnl|Hg17|chr10 (80875378-80875244) |
Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-120, gnl|bosTau2|chr28 (27696157-27696039) | |
1-120, gnl|Hg17|chr10 (80875378-80875244) |