Non-Coding RNA Search

Ss1.1-OvF8-UMC-p8mm4-009-h03.3

Sequence:


               
               CATCGAAAAACTTAATATTATGAAAAAAAAAACCTTGCCAAATATAAAATAAATAAAAAA
AAGGAAAGGAAACTTTGAACCTTATGTACCGAGCAATGGCCAGGTCTAGCAGACAATGCT
AGTCCTAGATTACTTATTGATTTAAAAACAACAAAAAAACCCCAAAAAAATAGTTAAATA
TAAAAACCAATTAATGTTTTATAGACCCTGGGAAAAGAATTTTCAGCAAAGTACAAAAAT
TTAAAGCATTCCTTTCTTTAATTTTGTAATTCTTTACTGTGGAATAGCTCAGAATGTCAC
TTCTGTTTGAAACAACAGAATTGATAACTGAGCAAGGAAACGTAATTTGGATTATAAAAT
TCTTGCTTTAATAAAAATTCCTTA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CATCGAAAAACTTAATATTATGAAAAAAAAAACCTTGCCAAATATAAAATAAATAAAAAA
AAGGAAAGGAAACTTTGAACCTTATGTACCGAGCAATGGCCAGGTCTAGCAGACAATGCT
AGTCCTAGATTACTTATTGATTTAAAAACAACAAAAAAACCCCAAAAAAATAGTTAAATA
TAAAAACCAATTAATGTTTTATAGACCCTGGGAAAAGAATTTTCAGCAAAGTACAAAAAT
TTAAAGCATTCCTTTCTTTAATTTTGTAATTCTTTACTGTGGAATAGCTCAGAATGTCAC
TTCTGTTTGAAACAACAGAATTGATAACTGAGCAAGGAAACGTAATTTGGATTATAAAAT
TCTTGCTTTAATAAAAATTCCTTA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               227-361, - strand, RNAz p=0.992657

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               227-361, - strand, RNAz p=0.992657

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               227-361, DB805729 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB805729.1|), blast E-value=0, identity=99.26% 
               

               
               227-361, POSM0100007_B05 porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|BM190238.1|), blast E-value=0, identity=100% 
               

               
               227-361, UMC-pd10en3-012-g12 Endometrium gilt D10 of estrous cycle pd10en 
(gb|CO987180.1|), blast E-value=0, identity=100% 
               

               
               227-361, UMC-pd3end3-012-e04 Endometrium gilt D3 of estrous cycle pd3end Sus 
(gb|CO989197.1|), blast E-value=0, identity=99.26% 
               

               
               227-361, UMC-pd3ov3-003-b05 Oviduct gilt D3 of estrous cycle pd3ov Sus 
(gb|CO990428.1|), blast E-value=0, identity=99.26% 
               

               
               227-361, UMC-pd0fol-006-g02 D0 ovarian follicle gilt standing estrus pd0fol 
(gb|CO993795.1|), blast E-value=0, identity=99.26%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               227-361, DB805729 full-length enriched swine cDNA library, adult skin Sus 
(dbj|DB805729.1|), blast E-value=0, identity=99.26% 
               

               
               227-361, POSM0100007_B05 porcine skeletal muscle cDNA library (PoSM) Sus 
(gb|BM190238.1|), blast E-value=0, identity=100% 
               

               
               227-361, UMC-pd10en3-012-g12 Endometrium gilt D10 of estrous cycle pd10en 
(gb|CO987180.1|), blast E-value=0, identity=100% 
               

               
               227-361, UMC-pd3end3-012-e04 Endometrium gilt D3 of estrous cycle pd3end Sus 
(gb|CO989197.1|), blast E-value=0, identity=99.26% 
               

               
               227-361, UMC-pd3ov3-003-b05 Oviduct gilt D3 of estrous cycle pd3ov Sus 
(gb|CO990428.1|), blast E-value=0, identity=99.26% 
               

               
               227-361, UMC-pd0fol-006-g02 D0 ovarian follicle gilt standing estrus pd0fol 
(gb|CO993795.1|), blast E-value=0, identity=99.26%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               155-361, gnl|bosTau2|chr19 (49581365-49581573)
               

               
               155-361, gnl|Hg17|chr8 (101784561-101784350)
               

               
               155-361, gnl|Mm7|chr3 (59561701-59561912)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               155-361, gnl|bosTau2|chr19 (49581365-49581573)
               

               
               155-361, gnl|Hg17|chr8 (101784561-101784350)
               

               
               155-361, gnl|Mm7|chr3 (59561701-59561912)

	227-361, DB805729 full-length enriched swine cDNA library, adult skin Sus (dbj\|DB805729.1\|), blast E-value=0, identity=99.26%
	227-361, POSM0100007_B05 porcine skeletal muscle cDNA library (PoSM) Sus (gb\|BM190238.1\|), blast E-value=0, identity=100%
	227-361, UMC-pd10en3-012-g12 Endometrium gilt D10 of estrous cycle pd10en (gb\|CO987180.1\|), blast E-value=0, identity=100%
	227-361, UMC-pd3end3-012-e04 Endometrium gilt D3 of estrous cycle pd3end Sus (gb\|CO989197.1\|), blast E-value=0, identity=99.26%
	227-361, UMC-pd3ov3-003-b05 Oviduct gilt D3 of estrous cycle pd3ov Sus (gb\|CO990428.1\|), blast E-value=0, identity=99.26%
	227-361, UMC-pd0fol-006-g02 D0 ovarian follicle gilt standing estrus pd0fol (gb\|CO993795.1\|), blast E-value=0, identity=99.26%

	155-361, gnl\|bosTau2\|chr19 (49581365-49581573)
	155-361, gnl\|Hg17\|chr8 (101784561-101784350)
	155-361, gnl\|Mm7\|chr3 (59561701-59561912)