Non-Coding RNA Search

Ss1.1-Ova2-C0003260_N22.5

Sequence:


               
               CTGACCTGGCCCATCCTAGGAGATGGGGGTGTAGCCCTTCCCGTACTCTCCCTGAACACT
GGAGTCTTCAGGACCCAGGGAGAGAGAGCCACTGCTTTTCCCAGGAGGCTCCAGGATTAG
GAAACATGTGTATTTAGTGAAAAATAGGTTTGTAGTGAAATAGTTACTATTTCATGAAAG
TAGATATTTTTAGAACTTTTGAAATAACACAGTTGTTTTCCTGGACTATGAGGAAAGGCA
CATTACATTTAGTCTTCCTTTCGATAAAACTCTTTGAAAAGAAATATGATTTTTAGAAAT
CAGCTGCCCCTTATAGCACAAAATCAGCCAAAGCGTAATTTAAAAGAATTGGCTTTTTTA
TTAGAATTCTTTTAGTTTCTTCCCATCCTTCTCAGTCTTATCTTGAGGGGCAGTCATCTG
AGAAAGAACTGCGTCATGTCTGAGCTTCGGAGTGTTCCCTGCGCGTGCACTGCTGACCCT
GGGAGCTGAGTC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CTGACCTGGCCCATCCTAGGAGATGGGGGTGTAGCCCTTCCCGTACTCTCCCTGAACACT
GGAGTCTTCAGGACCCAGGGAGAGAGAGCCACTGCTTTTCCCAGGAGGCTCCAGGATTAG
GAAACATGTGTATTTAGTGAAAAATAGGTTTGTAGTGAAATAGTTACTATTTCATGAAAG
TAGATATTTTTAGAACTTTTGAAATAACACAGTTGTTTTCCTGGACTATGAGGAAAGGCA
CATTACATTTAGTCTTCCTTTCGATAAAACTCTTTGAAAAGAAATATGATTTTTAGAAAT
CAGCTGCCCCTTATAGCACAAAATCAGCCAAAGCGTAATTTAAAAGAATTGGCTTTTTTA
TTAGAATTCTTTTAGTTTCTTCCCATCCTTCTCAGTCTTATCTTGAGGGGCAGTCATCTG
AGAAAGAACTGCGTCATGTCTGAGCTTCGGAGTGTTCCCTGCGCGTGCACTGCTGACCCT
GGGAGCTGAGTC

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               1-232, + strand, RNAz p=0.996713

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-232, + strand, RNAz p=0.996713

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               1-232, BX515214 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGp952O0430 
(emb|BX515214.1|), blast E-value=0, identity=95.26% 
               

               
               1-232, Shultzomica02863 Rat lung airway and parenchyma cDNA libraries 
(gb|CF109612.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_28455652 NIH_MGC_248 Rattus norvegicus cDNA clone 
(gb|CO557663.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_31479270 NIH_MGC_251 Rattus norvegicus cDNA clone 
(gb|CV079069.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_66933045 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY310907.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_70345055 NIH_MGC_368 Rattus norvegicus cDNA clone 
(gb|DY560956.1|), blast E-value=0, identity=100%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               1-232, BX515214 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGp952O0430 
(emb|BX515214.1|), blast E-value=0, identity=95.26% 
               

               
               1-232, Shultzomica02863 Rat lung airway and parenchyma cDNA libraries 
(gb|CF109612.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_28455652 NIH_MGC_248 Rattus norvegicus cDNA clone 
(gb|CO557663.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_31479270 NIH_MGC_251 Rattus norvegicus cDNA clone 
(gb|CV079069.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_66933045 NIH_MGC_367 Rattus norvegicus cDNA clone 
(gb|DY310907.1|), blast E-value=0, identity=100% 
               

               
               1-232, AGENCOURT_70345055 NIH_MGC_368 Rattus norvegicus cDNA clone 
(gb|DY560956.1|), blast E-value=0, identity=100%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               3' of AF251039, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               3' of AF251039, +

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               1-484, gnl|bosTau2|chr7 (34915193-34915678)
               

               
               1-484, gnl|Hg17|chr5 (137799748-137800232)
               

               
               1-484, gnl|Mm7|chr18 (35214226-35214702)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-484, gnl|bosTau2|chr7 (34915193-34915678)
               

               
               1-484, gnl|Hg17|chr5 (137799748-137800232)
               

               
               1-484, gnl|Mm7|chr18 (35214226-35214702)

	1-232, BX515214 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGp952O0430 (emb\|BX515214.1\|), blast E-value=0, identity=95.26%
	1-232, Shultzomica02863 Rat lung airway and parenchyma cDNA libraries (gb\|CF109612.1\|), blast E-value=0, identity=100%
	1-232, AGENCOURT_28455652 NIH_MGC_248 Rattus norvegicus cDNA clone (gb\|CO557663.1\|), blast E-value=0, identity=100%
	1-232, AGENCOURT_31479270 NIH_MGC_251 Rattus norvegicus cDNA clone (gb\|CV079069.1\|), blast E-value=0, identity=100%
	1-232, AGENCOURT_66933045 NIH_MGC_367 Rattus norvegicus cDNA clone (gb\|DY310907.1\|), blast E-value=0, identity=100%
	1-232, AGENCOURT_70345055 NIH_MGC_368 Rattus norvegicus cDNA clone (gb\|DY560956.1\|), blast E-value=0, identity=100%

	1-484, gnl\|bosTau2\|chr7 (34915193-34915678)
	1-484, gnl\|Hg17\|chr5 (137799748-137800232)
	1-484, gnl\|Mm7\|chr18 (35214226-35214702)