Non-Coding RNA Search

Ss1.1-Pig1-51L19.5

Sequence:


               
               GCGGACGCGTGGGTCGACCCACGCGTCCGCGGACGCGTGGGCGGACGCGTGGGGCCAGAG
CGGGGGACTCTTTCTGCACCATGTAGCATACTGGACTCCCAGCCCTGCCTGGCCCAAGGG
CGGGCCGGGGCCACCACTCCAGACCCAGCCCCGGCCTAGCCTGGGGCGCCCTGACACGGA
GACATGGACTCCAGGGGCCCTGGCTGAGAGAGAAGCCAGGGGAGAGAGGGCTGACGGACC
GTAGGCGGCAGTGACCGAGGGGGTGGGGACTGAGCCACCCGCCTCTGCCGCCCACCACCA
TCTCAGGAAAGGCTGCTGGTGCTGGCTGCCCGTTCCAGCTGCAGGGGTGGCACTGGGGGG
GGGGGTCTCTCTCCTGGGGCTCCTTCACTTTGGGCCTGGCCTAAGGCCCTTGGGGCTTCC
CCCCCTCCTCCTGGGGAGGGGGCCCGTGAAGAGCAA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GCGGACGCGTGGGTCGACCCACGCGTCCGCGGACGCGTGGGCGGACGCGTGGGGCCAGAG
CGGGGGACTCTTTCTGCACCATGTAGCATACTGGACTCCCAGCCCTGCCTGGCCCAAGGG
CGGGCCGGGGCCACCACTCCAGACCCAGCCCCGGCCTAGCCTGGGGCGCCCTGACACGGA
GACATGGACTCCAGGGGCCCTGGCTGAGAGAGAAGCCAGGGGAGAGAGGGCTGACGGACC
GTAGGCGGCAGTGACCGAGGGGGTGGGGACTGAGCCACCCGCCTCTGCCGCCCACCACCA
TCTCAGGAAAGGCTGCTGGTGCTGGCTGCCCGTTCCAGCTGCAGGGGTGGCACTGGGGGG
GGGGGTCTCTCTCCTGGGGCTCCTTCACTTTGGGCCTGGCCTAAGGCCCTTGGGGCTTCC
CCCCCTCCTCCTGGGGAGGGGGCCCGTGAAGAGCAA

Predicted RNA structure(s): 3 entry(ies)

More info

Predicted RNA structure(s): 3 entry(ies)

Help | Less info


               
               193-341, - strand, RNAz p=0.999032
               

               
               210-321, - strand, RNAz p=0.669198
               

               
               340-456, + strand, RNAz p=0.998334

Predicted RNA structure(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               193-341, - strand, RNAz p=0.999032
               

               
               210-321, - strand, RNAz p=0.669198
               

               
               340-456, + strand, RNAz p=0.998334

Predicted microRNA(s): 1 entry(ies)

More info

Predicted microRNA(s): 1 entry(ies)

Help | Less info


               
               237-330, - strand, RNAmicro p=0.911113

Predicted microRNA(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               237-330, - strand, RNAmicro p=0.911113

Similar Transcript(s): 7 entry(ies)

More info

Similar Transcript(s): 7 entry(ies)

Help | Less info


               
               251-341, mp67a07.r1 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGE 
(gb|AA117645.1|), blast E-value=1e-35, identity=96.7% 
               

               
               251-341, mp67a07.y1 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGE 
(gb|AI509400.1|), blast E-value=1e-35, identity=96.7% 
               

               
               252-341, 601775216F1 NCI_CGAP_Lu29 Mus musculus cDNA clone IMAGE 
(gb|BF168946.1|), blast E-value=2e-37, identity=97.78% 
               

               
               251-341, AGENCOURT_10165984 NCI_CGAP_Mam2 Mus musculus cDNA clone 
(gb|BU517805.1|), blast E-value=1e-35, identity=96.7% 
               

               
               251-341, AGENCOURT_16518041 NIH_MGC_222 Mus musculus cDNA clone 
(gb|CK020917.1|), blast E-value=1e-35, identity=96.7% 
               

               
               210-341, LIB3629-009-Q1-K6-H7 LIB3629 Canis familiaris cDNA clone 
(gb|DN365019.1|), blast E-value=2e-37, identity=90% 
               

               
               379-456, LIB3629-009-Q1-K6-H7 LIB3629 Canis familiaris cDNA clone 
(gb|DN365019.1|), blast E-value=0.000000000000002, identity=87.18%

Similar Transcript(s): 7 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               251-341, mp67a07.r1 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGE 
(gb|AA117645.1|), blast E-value=1e-35, identity=96.7% 
               

               
               251-341, mp67a07.y1 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGE 
(gb|AI509400.1|), blast E-value=1e-35, identity=96.7% 
               

               
               252-341, 601775216F1 NCI_CGAP_Lu29 Mus musculus cDNA clone IMAGE 
(gb|BF168946.1|), blast E-value=2e-37, identity=97.78% 
               

               
               251-341, AGENCOURT_10165984 NCI_CGAP_Mam2 Mus musculus cDNA clone 
(gb|BU517805.1|), blast E-value=1e-35, identity=96.7% 
               

               
               251-341, AGENCOURT_16518041 NIH_MGC_222 Mus musculus cDNA clone 
(gb|CK020917.1|), blast E-value=1e-35, identity=96.7% 
               

               
               210-341, LIB3629-009-Q1-K6-H7 LIB3629 Canis familiaris cDNA clone 
(gb|DN365019.1|), blast E-value=2e-37, identity=90% 
               

               
               379-456, LIB3629-009-Q1-K6-H7 LIB3629 Canis familiaris cDNA clone 
(gb|DN365019.1|), blast E-value=0.000000000000002, identity=87.18%

Homologous human UTR: 1 entry(ies)

More info

Homologous human UTR: 1 entry(ies)

Help | Less info


               
               5' of NM_014417, +

Homologous human UTR: 1 entry(ies)

Help | Less info

Human gene identifier and UTR site,
human gene reading direction


               
               5' of NM_014417, +

Aligned organism(s): 11 entry(ies)

More info

Aligned organism(s): 11 entry(ies)

Help | Less info


               
               53-456, gnl|bosTau2|chr18 (47199897-47199490)
               

               
               53-456, gnl|canFam2|chr1 (111636187-111635665)
               

               
               53-456, gnl|echTel1|scaffold_65459 (3322-3882)
               

               
               53-456, gnl|hg17|chr19 (52416180-52416699)
               

               
               53-456, gnl|Hg17|chr19 (52416831-52416434)
               

               
               53-456, gnl|mm7|chr7 (14080350-14079849)
               

               
               53-456, gnl|Mm7|chr7 (14079708-14080085)
               

               
               53-456, gnl|monDom2|scaffold_149 (1396078-1395694)
               

               
               53-456, gnl|oryCun1|scaffold_195585 (16087-15606)
               

               
               53-456, gnl|panTro1|chr20 (49723213-49723730)
               

               
               53-456, gnl|rheMac2|chr19 (53551595-53552111)

Aligned organism(s): 11 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               53-456, gnl|bosTau2|chr18 (47199897-47199490)
               

               
               53-456, gnl|canFam2|chr1 (111636187-111635665)
               

               
               53-456, gnl|echTel1|scaffold_65459 (3322-3882)
               

               
               53-456, gnl|hg17|chr19 (52416180-52416699)
               

               
               53-456, gnl|Hg17|chr19 (52416831-52416434)
               

               
               53-456, gnl|mm7|chr7 (14080350-14079849)
               

               
               53-456, gnl|Mm7|chr7 (14079708-14080085)
               

               
               53-456, gnl|monDom2|scaffold_149 (1396078-1395694)
               

               
               53-456, gnl|oryCun1|scaffold_195585 (16087-15606)
               

               
               53-456, gnl|panTro1|chr20 (49723213-49723730)
               

               
               53-456, gnl|rheMac2|chr19 (53551595-53552111)

	193-341, - strand, RNAz p=0.999032
	210-321, - strand, RNAz p=0.669198
	340-456, + strand, RNAz p=0.998334

	251-341, mp67a07.r1 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGE (gb\|AA117645.1\|), blast E-value=1e-35, identity=96.7%
	251-341, mp67a07.y1 Soares_thymus_2NbMT Mus musculus cDNA clone IMAGE (gb\|AI509400.1\|), blast E-value=1e-35, identity=96.7%
	252-341, 601775216F1 NCI_CGAP_Lu29 Mus musculus cDNA clone IMAGE (gb\|BF168946.1\|), blast E-value=2e-37, identity=97.78%
	251-341, AGENCOURT_10165984 NCI_CGAP_Mam2 Mus musculus cDNA clone (gb\|BU517805.1\|), blast E-value=1e-35, identity=96.7%
	251-341, AGENCOURT_16518041 NIH_MGC_222 Mus musculus cDNA clone (gb\|CK020917.1\|), blast E-value=1e-35, identity=96.7%
	210-341, LIB3629-009-Q1-K6-H7 LIB3629 Canis familiaris cDNA clone (gb\|DN365019.1\|), blast E-value=2e-37, identity=90%
	379-456, LIB3629-009-Q1-K6-H7 LIB3629 Canis familiaris cDNA clone (gb\|DN365019.1\|), blast E-value=0.000000000000002, identity=87.18%

	53-456, gnl\|bosTau2\|chr18 (47199897-47199490)
	53-456, gnl\|canFam2\|chr1 (111636187-111635665)
	53-456, gnl\|echTel1\|scaffold_65459 (3322-3882)
	53-456, gnl\|hg17\|chr19 (52416180-52416699)
	53-456, gnl\|Hg17\|chr19 (52416831-52416434)
	53-456, gnl\|mm7\|chr7 (14080350-14079849)
	53-456, gnl\|Mm7\|chr7 (14079708-14080085)
	53-456, gnl\|monDom2\|scaffold_149 (1396078-1395694)
	53-456, gnl\|oryCun1\|scaffold_195585 (16087-15606)
	53-456, gnl\|panTro1\|chr20 (49723213-49723730)
	53-456, gnl\|rheMac2\|chr19 (53551595-53552111)