Ss1.1-Pig2-128J01.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AGCTGTCAGATTGTTGTGAGAGTCTCATTGCTGTTCTGGAGTAAGTAAAGTATTTGTCTT CCTAGCCCCCCAAATCAAATCTGTTGCTTGTAAAATTCCTTTCTAATAAACATTTGTTAT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AGCTGTCAGATTGTTGTGAGAGTCTCATTGCTGTTCTGGAGTAAGTAAAGTATTTGTCTT CCTAGCCCCCCAAATCAAATCTGTTGCTTGTAAAATTCCTTTCTAATAAACATTTGTTAT |
| Aligned organism(s): 2 entry(ies) | More info |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
| 1-120, gnl|bosTau2|chr17 (27808631-27808516) | |
| 1-120, gnl|Hg17|chr12 (121627933-121628050) |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-120, gnl|bosTau2|chr17 (27808631-27808516) | |
| 1-120, gnl|Hg17|chr12 (121627933-121628050) |