Ss1.1-Pig2-132G10.5S
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| ACACCAGCCAGCCTCAGCCCCTCCGATGATGCAGGCCGCCGCCGCCGCCGGCCCACCTCT GGTGGCGGCCACACCGTATTCTTCCTACATCCCCTACAACCCCCACCA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| ACACCAGCCAGCCTCAGCCCCTCCGATGATGCAGGCCGCCGCCGCCGCCGGCCCACCTCT GGTGGCGGCCACACCGTATTCTTCCTACATCCCCTACAACCCCCACCA |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-108, gnl|bosTau2|chr25 (24926003-24925893) | |
| 1-108, gnl|Hg17|chr16 (28753356-28753463) | |
| 1-108, gnl|Mm7|chr7 (122590859-122590749) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-108, gnl|bosTau2|chr25 (24926003-24925893) | |
| 1-108, gnl|Hg17|chr16 (28753356-28753463) | |
| 1-108, gnl|Mm7|chr7 (122590859-122590749) |