Ss1.1-Pig2-43M03.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| ATTTTCATGTTTGTATTTTAATAATAAACTGCCTCCCATTTTTTCATGAGGATTAGAGCT GTAGTTTCTGCAGCTTTACTCAGACACAGTCCTCGTAATCCGAGGCCTCTGGCCAGTTTG GGCAGGGTTTCAGTTTTGCCTGGGTGGGATCAGACTCTTCAAAGTGAAAATATAAAAAAC TGGTTTGCATAT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| ATTTTCATGTTTGTATTTTAATAATAAACTGCCTCCCATTTTTTCATGAGGATTAGAGCT GTAGTTTCTGCAGCTTTACTCAGACACAGTCCTCGTAATCCGAGGCCTCTGGCCAGTTTG GGCAGGGTTTCAGTTTTGCCTGGGTGGGATCAGACTCTTCAAAGTGAAAATATAAAAAAC TGGTTTGCATAT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-142, + strand, RNAz p=0.999839 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-142, + strand, RNAz p=0.999839 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_015879, + |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-192, gnl|bosTau2|chr24 (43322089-43321881) | |
| 1-192, gnl|Hg17|chr18 (53178770-53178953) | |
| 1-192, gnl|Mm7|chr18 (64660481-64660666) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-192, gnl|bosTau2|chr24 (43322089-43321881) | |
| 1-192, gnl|Hg17|chr18 (53178770-53178953) | |
| 1-192, gnl|Mm7|chr18 (64660481-64660666) |