Ss1.1-Pig4-TMW8019D11.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TTTTTTTTTTTTTTTTTTCTTGTCCTTGGCCGGAGTCAAGGCAGGGTTGACTGTGAAAGG TTCTCCCATCACAGTGGGCTTGGGCTGAATGGGCTTGAGTTGGGGGCTGTTGCGAATAGC TTGAACCTGCGATCTGGGCACTCGAGGATCATACCC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TTTTTTTTTTTTTTTTTTCTTGTCCTTGGCCGGAGTCAAGGCAGGGTTGACTGTGAAAGG TTCTCCCATCACAGTGGGCTTGGGCTGAATGGGCTTGAGTTGGGGGCTGTTGCGAATAGC TTGAACCTGCGATCTGGGCACTCGAGGATCATACCC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-127, + strand, RNAz p=0.989996 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-127, + strand, RNAz p=0.989996 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 22-107, + strand, RNAmicro p=0.999747 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-127, gnl|bosTau2|chr10 (30583087-30582961) | |
| 1-127, gnl|Hg17|chr15 (62754305-62754179) | |
| 1-127, gnl|Mm7|chr9 (65733125-65733251) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-127, gnl|bosTau2|chr10 (30583087-30582961) | |
| 1-127, gnl|Hg17|chr15 (62754305-62754179) | |
| 1-127, gnl|Mm7|chr9 (65733125-65733251) |