Ss1.1-Pig4-TMW8027N17.3S
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AAATTATCCTGGTTTTGCAGCACTTTGATAATTGTGTGGATAAAACCGTACAAGCATTCA TGGAAGGTAGTGCCAGTGAAGTACTCAAAGAATGGACAGTAACAGGCA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AAATTATCCTGGTTTTGCAGCACTTTGATAATTGTGTGGATAAAACCGTACAAGCATTCA TGGAAGGTAGTGCCAGTGAAGTACTCAAAGAATGGACAGTAACAGGCA |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-108, gnl|bosTau2|chr13 (24678993-24679100) | |
| 1-108, gnl|Hg17|chr12 (48169558-48170773) | |
| 1-108, gnl|Mm7|chr15 (99158690-99159688) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-108, gnl|bosTau2|chr13 (24678993-24679100) | |
| 1-108, gnl|Hg17|chr12 (48169558-48170773) | |
| 1-108, gnl|Mm7|chr15 (99158690-99159688) |