Ss1.1-Pla1-C0000027_M23.5
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GAAACGTCATTTTAATTTCTCTTTTAAAAACCAGTTTAATTCTTACTGTGCCCATCATGA AGGCCTTTTTTGAAAGAAAAAAAAAAATCAAAATTACTCGTTTTGCCTCTAAGTACTCTG TATAAGATGTCTTGAGTAGAAGAAAAAAACTTTACCAAACCAAAGGTTGCTATTTTTGGA ATATCATATGTTCATTCCAGCAAGGCAGAAGACTGCACCTTCTTTCCAGTGACATGTTGT GTCATTTTTTTAAGTCCTCTTAATTTTTAGACACATTTTTGATTTGTGTTTTAACAAAGC CTGCCTAACCAGTCATCTTGTCTGCACCAATGCAAAGGTTTCTGAGAGGACTGTTGTATT CTCTATCCCTGTGGATATAAAGACACTGGCATTTCATTTCTCTTTCCCTTTCCTTTTTAA GGGATTTAACTTTGGAATCTTCCAAAGGAAGTTTGGCCAATGCCAGCT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GAAACGTCATTTTAATTTCTCTTTTAAAAACCAGTTTAATTCTTACTGTGCCCATCATGA AGGCCTTTTTTGAAAGAAAAAAAAAAATCAAAATTACTCGTTTTGCCTCTAAGTACTCTG TATAAGATGTCTTGAGTAGAAGAAAAAAACTTTACCAAACCAAAGGTTGCTATTTTTGGA ATATCATATGTTCATTCCAGCAAGGCAGAAGACTGCACCTTCTTTCCAGTGACATGTTGT GTCATTTTTTTAAGTCCTCTTAATTTTTAGACACATTTTTGATTTGTGTTTTAACAAAGC CTGCCTAACCAGTCATCTTGTCTGCACCAATGCAAAGGTTTCTGAGAGGACTGTTGTATT CTCTATCCCTGTGGATATAAAGACACTGGCATTTCATTTCTCTTTCCCTTTCCTTTTTAA GGGATTTAACTTTGGAATCTTCCAAAGGAAGTTTGGCCAATGCCAGCT |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 251-466, - strand, RNAz p=0.996933 | |
| 254-466, - strand, RNAz p=0.999938 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 251-466, - strand, RNAz p=0.996933 | |
| 254-466, - strand, RNAz p=0.999938 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 252-466, BP112897 ORCS bovine utero-placenta cDNA Bos taurus cDNA clone (dbj|BP112897.1|), blast E-value=0, identity=96.74% | |
| 251-466, CH3#018_G10T7 Canine heart normalized cDNA Library in pBluescript (gb|BU748247.1|), blast E-value=0, identity=94.98% | |
| 252-466, 4124397 BARC 8BOV Bos taurus cDNA clone 8BOV_35P15 5', mRNA (gb|CN789881.1|), blast E-value=0, identity=97.21% | |
| 252-466, 1244117 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN289263.1|), blast E-value=0, identity=97.21% | |
| 252-466, 1460187 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DT897814.1|), blast E-value=0, identity=96.28% | |
| 251-466, nbj16b06.y1 Human optic nerve. Unnormalized (nbj) Homo sapiens cDNA (gb|EB386426.1|), blast E-value=0, identity=93.06% | |
| 254-466, BP112897 ORCS bovine utero-placenta cDNA Bos taurus cDNA clone (dbj|BP112897.1|), blast E-value=0, identity=96.71% | |
| 254-466, CH3#018_G10T7 Canine heart normalized cDNA Library in pBluescript (gb|BU748247.1|), blast E-value=0, identity=94.91% | |
| 254-466, 4124397 BARC 8BOV Bos taurus cDNA clone 8BOV_35P15 5', mRNA (gb|CN789881.1|), blast E-value=0, identity=97.18% | |
| 254-466, 1244117 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN289263.1|), blast E-value=0, identity=97.18% | |
| 254-466, 1460187 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DT897814.1|), blast E-value=0, identity=96.24% | |
| 254-466, nbj16b06.y1 Human optic nerve. Unnormalized (nbj) Homo sapiens cDNA (gb|EB386426.1|), blast E-value=0, identity=92.96% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 252-466, BP112897 ORCS bovine utero-placenta cDNA Bos taurus cDNA clone (dbj|BP112897.1|), blast E-value=0, identity=96.74% | |
| 251-466, CH3#018_G10T7 Canine heart normalized cDNA Library in pBluescript (gb|BU748247.1|), blast E-value=0, identity=94.98% | |
| 252-466, 4124397 BARC 8BOV Bos taurus cDNA clone 8BOV_35P15 5', mRNA (gb|CN789881.1|), blast E-value=0, identity=97.21% | |
| 252-466, 1244117 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN289263.1|), blast E-value=0, identity=97.21% | |
| 252-466, 1460187 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DT897814.1|), blast E-value=0, identity=96.28% | |
| 251-466, nbj16b06.y1 Human optic nerve. Unnormalized (nbj) Homo sapiens cDNA (gb|EB386426.1|), blast E-value=0, identity=93.06% | |
| 254-466, BP112897 ORCS bovine utero-placenta cDNA Bos taurus cDNA clone (dbj|BP112897.1|), blast E-value=0, identity=96.71% | |
| 254-466, CH3#018_G10T7 Canine heart normalized cDNA Library in pBluescript (gb|BU748247.1|), blast E-value=0, identity=94.91% | |
| 254-466, 4124397 BARC 8BOV Bos taurus cDNA clone 8BOV_35P15 5', mRNA (gb|CN789881.1|), blast E-value=0, identity=97.18% | |
| 254-466, 1244117 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN289263.1|), blast E-value=0, identity=97.18% | |
| 254-466, 1460187 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DT897814.1|), blast E-value=0, identity=96.24% | |
| 254-466, nbj16b06.y1 Human optic nerve. Unnormalized (nbj) Homo sapiens cDNA (gb|EB386426.1|), blast E-value=0, identity=92.96% |
| Aligned organism(s): 14 entry(ies) | More info |
| Aligned organism(s): 14 entry(ies) | Help | Less info |
| 1-466, gnl|bosTau2|chr1 (30127593-30127116) | |
| 1-466, gnl|canFam2|chr33 (26499871-26500337) | |
| 1-466, gnl|dasNov1|scaffold_4646 (40963-41406) | |
| 1-466, gnl|galGal2|chr1 (74234562-74234076) | |
| 1-466, gnl|hg17|chr3 (121024228-121024687) | |
| 1-466, gnl|Hg17|chr3 (121024826-121024377) | |
| 1-466, gnl|loxAfr1|scaffold_21401 (31365-30918) | |
| 1-466, gnl|mm7|chr16 (37951556-37951072) | |
| 1-466, gnl|Mm7|chr16 (37950929-37951398) | |
| 1-466, gnl|monDom2|scaffold_24 (16566673-16567186) | |
| 1-466, gnl|oryCun1|scaffold_179670 (5018-5488) | |
| 1-466, gnl|panTro1|chr2 (122747239-122747701) | |
| 1-466, gnl|rheMac2|chr2 (39855838-39856303) | |
| 1-466, gnl|rn3|chr11 (64337944-64338415) |
| Aligned organism(s): 14 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-466, gnl|bosTau2|chr1 (30127593-30127116) | |
| 1-466, gnl|canFam2|chr33 (26499871-26500337) | |
| 1-466, gnl|dasNov1|scaffold_4646 (40963-41406) | |
| 1-466, gnl|galGal2|chr1 (74234562-74234076) | |
| 1-466, gnl|hg17|chr3 (121024228-121024687) | |
| 1-466, gnl|Hg17|chr3 (121024826-121024377) | |
| 1-466, gnl|loxAfr1|scaffold_21401 (31365-30918) | |
| 1-466, gnl|mm7|chr16 (37951556-37951072) | |
| 1-466, gnl|Mm7|chr16 (37950929-37951398) | |
| 1-466, gnl|monDom2|scaffold_24 (16566673-16567186) | |
| 1-466, gnl|oryCun1|scaffold_179670 (5018-5488) | |
| 1-466, gnl|panTro1|chr2 (122747239-122747701) | |
| 1-466, gnl|rheMac2|chr2 (39855838-39856303) | |
| 1-466, gnl|rn3|chr11 (64337944-64338415) |